#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:37 GMT TreeBASE (cc) 1994-2008 Study reference: Morgan D., Korn R., & Mugleston S. 2009. Insights into reticulate evolution in Machaerantherinae (Asteraceae: Astereae): 5S ribosomal RNA spacer variation, estimating support for incongruence, and constructing reticulate phylogenies. American Journal of Botany, 96: 920-932. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S9935] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=34; TAXLABELS Arida_blepharophylla Arida_parviflora Arida_riparia Arida_turneri Corethrogyne_filaginifolia Dieteria_bigelovii Dieteria_canescens Grindelia_ciliata Haplopappus_glutinosus Hazardia_squarrosa Herrickia_kingii Isocoma_veneta Lessingia_glandulifera Machaeranthera_tanacetifolia Oonopsis_engelmannii Oonopsis_wardii Psilactis_brevilingulata Pyrrocoma_crocea Pyrrocoma_lanceolata Rayjacksonia_phyllocephala Symphyotrichum_drummondii Xanthisma_blephariphylla Xanthisma_coloradoense Xanthisma_crutchfieldii Xanthisma_gracile Xanthisma_grindelioides Xanthisma_gymnocephalum Xanthisma_rhizomatum Xanthisma_spinulosum Xanthisma_stenolobum Xanthisma_texanum Xanthisma_viscidum Xanthocephalum_gymnospermoides Xylorhiza_wrightii ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=35; TAXLABELS Arida_blepharophylla_1 Arida_blepharophylla_2 Arida_blepharophylla_3 Arida_blepharophylla_4 Arida_blepharophylla_5 Arida_blepharophylla_6 Arida_blepharophylla_7 Arida_blepharophylla_8 Arida_parviflora_1 Arida_parviflora_2 Arida_parviflora_3 Arida_parviflora_4 Arida_riparia_1 Arida_riparia_2 Arida_riparia_3 Arida_riparia_4 Arida_riparia_5 Arida_riparia_6 Arida_riparia_7 Arida_riparia_8 Arida_turneri_1 Arida_turneri_2 Arida_turneri_3 Dieteria_bigelovii_1 Dieteria_bigelovii_2 Dieteria_bigelovii_3 Dieteria_canescens_1 Dieteria_canescens_2 Dieteria_canescens_3 Machaeranthera_tanacetifolia_1 Xanthisma_texanum_1 Xylorhiza_wrightii_1 Xylorhiza_wrightii_2 Xylorhiza_wrightii_3 Xylorhiza_wrightii_4 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=98; TAXLABELS Arida_blepharophylla_1 Arida_blepharophylla_2 Arida_blepharophylla_3 Arida_blepharophylla_4 Arida_parviflora_124 Arida_parviflora_3 Arida_riparia_14 Arida_riparia_2 Arida_riparia_3 Arida_turneri_12 Arida_turneri_3 Corethrogyne_filaginifolia_1 Corethrogyne_filaginifolia_2 Corethrogyne_filaginifolia_3 Dieteria_bigelovii_1 Dieteria_bigelovii_2 Dieteria_bigelovii_3 Dieteria_canescens_1 Dieteria_canescens_2 Dieteria_canescens_3 Grindelia_ciliata_1 Grindelia_ciliata_23 Haplopappus_glutinosus_1 Haplopappus_glutinosus_2 Haplopappus_glutinosus_3 Hazardia_squarrosa_1 Hazardia_squarrosa_2 Hazardia_squarrosa_3 Hazardia_squarrosa_4 Herrickia_kingii_1 Isocoma_veneta_1 Isocoma_veneta_2 Isocoma_veneta_3 Lessingia_glandulifera_1 Lessingia_glandulifera_2 Lessingia_glandulifera_3 Machaeranthera_tanacetifolia_1 Machaeranthera_tanacetifolia_2 Machaeranthera_tanacetifolia_3 Oonopsis_engelmannii_1 Oonopsis_engelmannii_2 Oonopsis_engelmannii_3 Oonopsis_wardii_1 Oonopsis_wardii_2 Oonopsis_wardii_3 Psilactis_brevilingulata_1 Pyrrocoma_crocea_1 Pyrrocoma_crocea_24 Pyrrocoma_crocea_3 Pyrrocoma_lanceolata_1 Pyrrocoma_lanceolata_2 Pyrrocoma_lanceolata_3 Pyrrocoma_lanceolata_4 Rayjacksonia_phyllocephala_123 Symphyotrichum_drummondii_1 Xanthisma_blephariphyllum_1 Xanthisma_blephariphyllum_2 Xanthisma_blephariphyllum_3 Xanthisma_coloradoense_1 Xanthisma_coloradoense_2 Xanthisma_coloradoense_3 Xanthisma_coloradoense_4 Xanthisma_crutchfieldii_1 Xanthisma_crutchfieldii_2 Xanthisma_crutchfieldii_3 Xanthisma_gracile_1 Xanthisma_gracile_2 Xanthisma_gracile_3 Xanthisma_grindelioides_1 Xanthisma_grindelioides_24 Xanthisma_grindelioides_3 Xanthisma_gymnocephalum_1 Xanthisma_gymnocephalum_2 Xanthisma_gymnocephalum_3 Xanthisma_rhizomatum_1 Xanthisma_rhizomatum_2 Xanthisma_rhizomatum_3 Xanthisma_rhizomatum_4 Xanthisma_spinulosum_1 Xanthisma_spinulosum_2 Xanthisma_spinulosum_3 Xanthisma_stenolobum_1 Xanthisma_stenolobum_2 Xanthisma_stenolobum_3 Xanthisma_stenolobum_4 Xanthisma_stenolobum_5 Xanthisma_texanum_1 Xanthisma_texanum_2 Xanthisma_texanum_3 Xanthisma_viscdum_1 Xanthisma_viscdum_2 Xanthisma_viscdum_345 Xanthocephalum_gymnospermoides_12 Xanthocephalum_gymnospermoides_3 Xylorhiza_wrightii_1 Xylorhiza_wrightii_2 Xylorhiza_wrightii_3 Xylorhiza_wrightii_4 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4706] TITLE 5S_dataset_2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=213; FORMAT DATATYPE=Standard SYMBOLS= "A C G T 0 1 2 3" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arida_blepharophylla TGTCG{CT}A{CG}{AG}CGCTCG{CT}GAAAGTCGGGGAAACGAGAA{AT}{AT}-GCAG{AG}AGACTGACGGGCGCGGGGAGTGACCGGG{AG}CGGA{AG}TAAG{AT}A{ACT}{GT}T{CT}GAAG{AG}GGTTA{CT}-C{AG}GGTTG{AG}AAGGAGCCCG{CG}GAGGCGACATA{AC}G{AG}GTGAACAAAAGGGGG-{AC}GGGGACTTC{CT}TGGGGTAAGGGATAAAAGAATTAA{AC}{AC}AG{AC}GGATGT{AG}TTTCGGTTGCG110110 Arida_parviflora TGTCGCAGG{AC}GCTCGCGAAAGTCGAGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG110110 Arida_riparia --------GCGCTCGCGGAAGCCGTGGAAACGAGAAAA-GCAAA{AG}GACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTAC-G{AG}GCTTGAAACG{AG}GCCCGTGAGGCGACATACGGGTGAACAAAAGGAGG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110110 Arida_turneri TGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCC{AG}TGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG110110 Corethrogyne_filaginifolia -----------------------------------------------------------------------------------------------TTGC-GG{AG}GTTGAAACGGGCGCGTGAGACGGCGTACGGGTGAGCAAACGGATG-AGGGAACTTCCTGGGTTGA{GT}GGATAAAAGAATTAAAC{AG}AAGGA{CT}GTATTTCGGTTGCG110110 Dieteria_bigelovii TGTCGC{AG}GGCGCTCGCGAAAGTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGGGACA{CT}ACGGGTGAACAAAAGGGGG-A-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGC{AG}GAGGAT{AG}TATTTCGGTTGCG110100 Dieteria_canescens TGTCGCAGGCGCTCGCGAAA{GT}TCGTGGAAACGAGAAAA-GAAGAAGACTG{AG}CGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTT{AG}AAACG---------GGCGACATACGGGTGAACAAAAGGGGG-A{GT}GGGGCTTCCTGGGGAAAGGGATAAAAGA{AG}TTAAGCAGAGGATGTATTTCGGTTGCG110100 Grindelia_ciliata -------------------------------------------------AA-AGGCGGGGTGAGCGACCGGGACGTAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGA{CG}GTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGTAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110110 Haplopappus_glutinosus CGTCGCAGGCGCTCGCGGAAGTCTGGGAGACTAGAAAC-GCCAAA{GT}AC{AG}GACGGC{CG}GCG{CGT}GT{AG}GCGACCGGGACGAAG{GT}{AC}AGACGTTCGGAGAGGTTGC-GGGGTTGAAACGAGCCCGTGAGGCG{AT}CGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGTTT{AT}GGGATAAAAGAA{CT}TAAACGAAGGATGTCTTTCGGTTGCG110110 Hazardia_squarrosa CG{AC}CGCAGGCGCT{CT}GCGGAAG{CT}CTGGGAGACGAGAAAA-GCCAAAGACGGACGGGCGCG{GT}GGAGCGACCGGGA{CT}GAAGTAAGACGTTCGGAGGGGTTAC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAA{CT}GGATG-{AG}GGGAACTTCCTGGGTT{AG}AGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG110110 Herrickia_kingii -------GGCGCTCGCGAAATCCGGGGAAATGGGAAAA-GCAAGAGACGGACGGGCGCGTGGAGTGACCGAGACGAAGCAAGACGTTCGGAGAGGATAC-CGGGTTGAAACGAGCCCGTGAGGCGACATACGAGTGAACAAATGGAGG-AGGGAACTTCATGGGTGAAGGGATAAAAGAATTAAACAATGGATGAATTTTGGTTGCG110110 Isocoma_veneta CGTCGCAGGCGCTCGCGGAAGTCCTGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACCGGGACGAAGTAGGACGTTCGGAGAGGTTAC-GGG-CTG{AT}AACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACCTCCTGGGAAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110010 Lessingia_glandulifera -----------------------------------------------------------------------------------------------TTGC-GGGGCTAAAACGTGACCGCGAGA{CT}GACGTACGGGTGAGCAAATGGATG-AGGG{AG}A{CG}T{CT}C{CG}TGGGTTGA{GT}GG{AC}TAAAAGAATTAA{AG}CGAAGGA{CT}GTATTT{CT}GGTTGCG110110 Machaeranthera_tanacetifolia CGTCGCAGGCGGTCGCGGAAGTGC{AG}GGAAAGGAGAGAA-GCAAAAGACGGACGGGCGCGGGGAGCTCC-GGGAA{GT}AAGTAAGACGTTCGGAGCGGTTGT-CGGGTTGAAACGAGCCCGTGACGCGACGTACAGGTGAACAAATGGATG-AG{GT}AAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGAATGTATTTCGGTTGCG100110 Oonopsis_engelmannii CGACGCAGGCGCGCGCGGAAGTGTGGGAAACGAGAGAA-GCGAAAGACGGACGGGCGCGGGGAGCTTC-GGGGAGAAGTAAGACGTCCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG100111 Oonopsis_wardii {AC}GACGCAGGCGCGCGCGGAAGTG{CT}GGGAAACGAGAGGA-GCAAAAGACGGAC{AG}{AG}GCGCGGGGAG{AC}TTC-GGGAAGA{AG}GTAAGAC{AG}T{CT}CGGAGAGGT{CT}G{CT}-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGG{AG}AAGTTCATGGGGTAAGGGATAAAAGAATT{AT}AACAAAGGATGTATTTCGGTTGCG100111 Psilactis_brevilingulata -------GGCGCTCGCGAAAGTCGGGGAAACGAGAAAA-GCAAAAGACGGGCGGGCGGGGGGAGTGACTGGGGTGAAGTAAGACGTTCGGAGAGGATAC-CGGGCTGAAACGAGCCAGTGAGGCGGCATACGGGTGAACAAATGGAGG-AGGGAAGTTCCTGGGGTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG110110 Pyrrocoma_crocea CG{GT}CG{CG}CGGCG{AC}TCGCGGAAG{CT}C{AC}GGGAGACGAGAAAAA{CG}CAAAAG{AT}{CG}GGGCGGGCGCGGGGAGCGACCGGGACGAAGTA{AC}GACGTTCGGAGAGG{CT}TAC-GGGG{CT}TGAAACGGGCCCGT{CG}AGGCGACGTACGGGTGAACAAATGGATG-AGGGGACTTCCTGGGGTAAGGGATAAAAG{AG}ATTAA{AG}CGAGGGATGTATTT{AC}GGTTGCG111110 Pyrrocoma_lanceolata CGG{CG}G{GT}CGG{CG}GCTCGCGGAA{GT}{CG}CAGGGGGA{AC}GAGAAAAAGCAAAAG{AT}CGGACGGCCGCGGGGAGCGA{AC}CGGGACGAA{GT}TAAGACGTT{CT}GGAGAGGCTAC-GGGGC{AT}GAAACGGGCCCGTGAGGCGACGTACGG{AG}TGAACAAATGGATG-AGGGAACTTCC{CT}GGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTT{AC}GGTTGCG111110 Rayjacksonia_phyllocephala --------------GCGGAAGTCCGGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACGGGGACGAAGGAGGACGTTCGGAGAGGTTAC-GGG-CTGAAACGAGGGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110010 Symphyotrichum_drummondii -------G-CGCTCGCGAAAGTCTGGGAAACGAGAAAA-GCAAAAGACGGACGGGCGCGGGTAGTGACCGGGATGAAGTAATACGTTCGGAGAGGATAC-CGGGTTGAAACGAGCCAGTGAGGCGACATACGGGTGAACAAGTGGAGG-AGGGAGCTTCCTGGGGTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG110110 Xanthisma_blephariphylla -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGT{CT}GAAACGGGCCCGTGAGGCGACGTACGGGTGA{AG}C{AG}G{AG}TGGACG-AGG{AG}AACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAG{CG}A{GT}GTATTTCGGTTGCG110110 Xanthisma_coloradoense -----------------------------------------------------------GG{CG}AGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTT{AG}C-CGGGTTGAAAC{CG}GGCCCGT{AG}AGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAG{AG}ATAAAACAAAGGATGTATTTCGGTTGCG110110 Xanthisma_crutchfieldii CGTCG{CT}AGGCGCTCCCGGAAGTCTGGGAAACGAGAGA{AG}-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCC{CT}GGGGTAAGG{GT}ATAAAA{GT}AATAAAACAAA{AG}GATGTATTTCGGTTGCG110110 Xanthisma_gracile CG{CT}CGCGG{AG}CCCTCGCGGAAGTCCGGGAAAGGAGAGAA-GCAGAAGGC{GT}GACG----------------------AAGTAAGACGTTCGGGGCGGTTTTACGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATG{CG}ACG-AGGGAACGTCCTGGGGTAAGGGATAAAAGA{AG}TTAAACAAAGGGTGTATTTCGGTTGCG010110 Xanthisma_grindelioides -----------------------------------------------------------GGGA{AG}{CG}GACCGGGACGAAGTAAGA{CT}GTT{AC}GGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAA{AC}GGATTGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAG{AG}ATGTATTTCGATTGCG110110 Xanthisma_gymnocephalum -----------------------------------------------------------------------------------CGTTCGG{AG}GAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGG{AG}CG-AGGGAACTTCCTGGGGTAAGGGATAAAAGATTAAAACAAAG{CT}ATGTATTTCGGTTGCG110110 Xanthisma_rhizomatum CGTCGCA{CG}GCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTC{GT}{CG}AGAGGTTTC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGCACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTT{CT}GGTTGCG110110 Xanthisma_spinulosum CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAG{GT}AGAGAA-GC{AT}AAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGT{AT}AGGGATAAAAGAATTAAACAA{AC}GGGTGTATTTCGGTTGCG010110 Xanthisma_stenolobum CGTCGCGGGCG{CT}TGGCGGAAGTCCGGGAAAGGAGAGAA-G{CT}AAAAGGCGGACG-------------ACCGGGACGAAGTAAGA{AC}GTTCGGAGAGGTTG{CT}-CGGGCTGAAACGAG{CG}CCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTG{AG}GGTAAGGGATAAAAGAATTAAACAAAGG{AG}TGTATTTCGGTTGCG010110 Xanthisma_texanum CGTCGCAGGCGCTCG{CG}GGAAGTCCGGGAAACGAG{AG}GAA-GCAAAAGACGGACGGGCG{AG}GGGGAGCGACCGGGACGA{AG}A{CT}AAGACGTTCGGAGAGGTTGC-CGGGTT{AG}AAACGAT{CG}CCGCGAGGCGACGTACGGGTGAGCAAAAGGA{AG}{AG}-AGGGAACTTCCTG{AG}G{AG}TAAAGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG110110 Xanthisma_viscidum CGTCGCAGGCGCTCGCGGGAGTACGGGAAACGAGAGAA-GCAAAAGAGGGACGGGCGCGGGGAGCGACCGGGACGAGGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAAC{AG}AGCCCGTGAGGCGAGGCACGGGTGAACAGATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATT{GT}CGGTTGCG110110 Xanthocephalum_gymnospermoides ----------------------------------AAAA-GCAAAAGACGGACGGGCGCGGGGAGCGACCGGGAC{GT}AAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGGACTTCCTGGGGAAATGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110110 Xylorhiza_wrightii TGTCGCAGGC{AG}CCCGCGAAAGACGTGGAAACGAGAAA{AG}-GCAAAAGACTGACGGGCGC{AG}GGGAGTGACCGGGAAGAA{AG}TAAGA{CT}GTTCGGTGA{GT}GTTAC-C{CT}GGTTGAAACGAGCCCGTGAGGCGACA{CT}A-GGGTGAACAAAA{AG}GGGG-AGGGAACTTCC{CT}GG{GT}GTAAGGGATAAAACCATTAAACAGAGGATGT{AT}TTTCGGTTGCG110110 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4449] TITLE 5S_dataset_4; LINK TAXA = Taxa2; DIMENSIONS NCHAR=416; FORMAT DATATYPE=Standard SYMBOLS= "A C G T 0 1 2 3" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arida_blepharophylla_1 TTGCAACCCTTTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTTATATATAACTT-------------TTTTTT-TTGTTAATGGAATTTATAAGTATTATCGTCAAAACATATATTTTGTATGACGGG------GGGGA-------AA-CGTTTATATTTAT---TTAATAAAAGCAGTGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAAGCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGATGTTCGAAGAGGTTACCGGGTTGAAAGGAGCCCGGGAGGCGACATAAGAGTGAACAAAAGGGGGCGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTATTTCGGTTGCG011111 Arida_blepharophylla_2 TTGCAACCCTTTTTTTGTTTTT-GTAATTCGTTCTTCAGTCAAGTGATGCTATTTTGGTTTGTTTCTTTTTATATATAACTTTTTTTTT-----CTTTTTTTCTATTAATGGAATTTATAAGTATTATCGTCAAAACATATATTTTATATGACGGG------GGTGAA------AAACGTTTATATTAAT---TTAATAAAAGTTGAGTCGCACACGCTCGTGAAAGTCGGGGAAACGAGAATAGCAGGAGACTGACGGGCGCGGGGAGTGACCGGGGCGGAATAAGTCGTTCGAAGAGGTTATCGGGTTGGAAGGAGCCCGCGAGGCGACATACGGGTGAACAAAAGGGGGAGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_blepharophylla_3 TTGCAACCCTTTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTTATATATAACTT-------------TTTTTT-TTGTTAATGGAATTTATAAGTATTATCGTCAAAACATATGTTTTGTATGACGGG------GGGGA-------AAACGTTTATATTTAT---TTAATAAAAGCAGTGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAATGCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGATGTTCGAAGAGGTTACCAGGTTGAAAGGAGCCCGGGAGGCGACATAAGAGTGAACAAAAGGGGGAGGGGACTTCTTGGGGTAAGGGATAAAAGAATTAACAAGCGGATGTATTTCGGTTGCG011111 Arida_blepharophylla_4 TTGCAACCCTTTTTTTGTTTTT-GTAATTTGTTTTTCAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTATATATAACTTTT-----------TTTTTTGTTGTTAATGGAATTTATAAGTATTATCGTCAAAACATATATTTTGTATGACGGG------GGGAA-------AAACGTTTATATTTAT---TTAATAAAAGCTGTGTCGTAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAAGCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGAAGTTCGAAGGGGTTACCGGGTTGAAAGGAGCCCGGGAGGCGACATAAGGGTGAACAAAAGGGGGAGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTGTTTCGGTTGCG011111 Arida_blepharophylla_5 TTGCAACCCTTTTTTGGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTTATATATAACTTCT-----------TTTTTT-TTGTTAATGGAATTTATAAGTATTATCGTCAAAACATATATTTTGTATGACGGG------GGGAA-------AAACGTTTATATTTAT---TTAATAAAAGCTGTGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAAGCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGAAGTTCGAAGAGGTTACCGGGTTGAAAGGAGCCCGGGAGGCGACATAAGGGTGAACAAAAGGTGGAGGGGACTTCCGGGGGTAAGAGATAAAAGAATTAACAAGAGGATGTATTTCGGTTGCG011111 Arida_blepharophylla_6 TTGCAACCCTTTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTTATATATAACTT-------------TTTTTT-TTGTTAATGGAATTTATAAGTATTATCGTCAAAACATATAATTTGTATGACGGG------GGGGA-------AAACGTTTATATTTAT---TTAATAAAAGCAGTGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGTAAAGCAGAAGACTGACGGGCGCGGGGAGTCACCGGGACGGAGTAAGATGTTCGAAGAGGTTACCGGGTTGAAAGGAGCCCGGGAGGCGACATAAGAGTGAACAAAAGGGGGAGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTATTTCGGTTGCG011111 Arida_blepharophylla_7 TTGCAATCCTTTTTTTGTTTTT-GTAAATCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTTATATATAACTT-------------TTTTTT-TTGTTAATGGA-TTTATAAGTATTATCGTCAAAACATATATTTTGTATGACGGG------GGGAA-------AAACGTTTATATTTAT---TTAATAAAAGCTGTGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAAGCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGAAGTTCGAAGAGGTTACCGGGTTGAAAGGAGCCCGGGAGGCGACAAAAGGGTGAACAAAAGGGGGAGGGGACTTCCAGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTATTTCGGTTGCG011111 Arida_blepharophylla_8 TTGCAACCCTTTTTTTGTTTTT-GTAATTCATTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTTATATATAACTTCT-----------TTTTTT-TTGTTAATGGAATTTATAAGTATTATCGTCAAAACATATATTTTGTATGACGGG------GGGGGGGGGGGGAAACGTTTATATTTAT---TTAATAAAAGCAGTGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAAGCAGAAGACTGACGGGCGCGGGGAGTGACCAGGACGGAGTAAGATGTTCGAAGAGGTTACCGGCTTGAAAGGAGCCCGGGAGGCGACAGAAGAGTGAACATAAGGGGGAGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTATTTCGGTTGCG011111 Arida_parviflora_1 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAAT-----TTTT-----TTTTTTTTT-GTTAATGGAATATATAATTACTATAGTAAAAAAATACATTTTGTTTGACGGG------GGGGA---------ACGTTTATTTGTAC---TTAATAAAAGCCGTGTCGCAGGCGCTCGCGAAAGTCGAGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_parviflora_2 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAAT-----TTTT-----TTTTTTTT--GTTAATGGAATATATAATTACTATAGTCAAAAAATACATTTTGTTTGACGGG------GGGAA---------ACGTTTATTTGTAC---TTAATAAAAGCCGTGTCGCAGGCGCTCGCGAAAGTCGAGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_parviflora_3 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAAT-----TTTT-----TTTTTTTTT-GTTAATGGAATATATAATTACTATAGTCAAAAAATACATTTTGTTTGACGGG------GGGGA---------ACGTTTATTTGTAC---TTAATAAAAGCCGTGTCGCAGGAGCTCGCGAAAGTCGAGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_parviflora_4 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAAT-----TTTT-----TTTTTTTTTTGTTAATGGAATATATAATTACTATAGTCAAAAAATACATTTTGTTTGACGGG------GGGAA---------ACGTTTATTTGTAC---TTAATAAAAGCCGTGTCGCAGGCGCTCGCGAAAGTCGAGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_riparia_1 TTGCAACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----T--GTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACGGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAGGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_2 TTGCGACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----TT-GTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACAGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAGGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGAGCTTGAAACGGGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_3 GTGCAACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----GT-GTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACGGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_4 TTGCAACCCTCTTTTTGTTTTTTGTAAATCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----TTTGTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACGGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGGCGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGCAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_5 TTGCAACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----TTTGTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGATGGG------C------------------------------------------------CGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_6 TTGCAACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----TT-GTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACGGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAGGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_7 TTGCAACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----TTTGTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACGGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_riparia_8 TTGCAACCCTCTTTTTGTTTTTTGTAATTCGTTTTTCTTCTTGGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTT--TTTT-----TT-GTTTTTTGTTAATGGAATTTATAATTACGATCGTAAAAAAACAGATTTTGTTTGACAGG------G-----------------------------------------------GCGTGCGCTCGCGGAAGCCGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTACGGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGGAGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110111 Arida_turneri_1 TTGCAACCCTCTTTTTGTTTTT-GTAATTTGTTTTTGAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAAT-----TTTT-----TTTTTTTTTTGTTAATGGAATTTATAATTACTATAGTCAAAAAATACATTTTGTTTGACGGG------GAGGA---------ACGTTTATCTGTAC---TTAATAAAAGCCGTGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_turneri_2 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTGAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATATT--TTTT-----TTTTTTTTTTGTTAATGGAATTTGTAATTACTATAGTCAAAAAATACATTTTGTTTGACGGG------GAGGA---------ACGTTTATCTGTAC---TTAATAAAAGCCGTGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Arida_turneri_3 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTCTTTGAGCCAAGGGTTGCGATTTTGGTTTGTTTCTTTTTAGATACAATTTTTTTTTT-----TTTTTTTTTTGTTAATGGAATTTATAATTACTATAGTCAAAAAATACATTTTGTTTGACGGG------GAGGA---------ACGTTTATCTGTAC---TTAATAAAAGCCGTGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAAGAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTACCGGTTTGAAACGAGCCCATGAGGCGACATACGGGTGAACAAAAGTAGGAGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG011111 Dieteria_bigelovii_1 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCATGGGTTGCTATTTTGGTTTGTTTCTTTTCGTATATGATTT--TTTTT-----------TTTGGTTAATGGAACTTATAAGTACTATCGCCAAAACGTATATTTTGTACGACGGG------GGGAA--------AACGTTTATATTTGT---TAAATAGAAGTGGTGTCGCAGGCGCTCGCGAAAGTCGTGGAAACGAGAAAAGAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTACCGGCTTGAAACG---------GGGGACATACGGGTGAACAAAAGGGGGA-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATGTATTTCGGTTGCG011100 Dieteria_bigelovii_2 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTCGTATATGATTTTATTTTT-----------TTTGGTTAATGGAACTTATAAGTATTATCGCCAAAACGTATATTTTGTACGACGGG------GGGAA--------AACGTTTATATTTGT---TAAATAGAAGTGGTGTCGCAGGCGCTCGCGAAAGTCGTGGAAACGAGAAAAGAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTACCGGCTTGAAACG---------GGGGACATACGGGTGAACAAAAGGGGGA-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCGGAGGATGTATTTCGGTTGCG011100 Dieteria_bigelovii_3 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTCGTATATGATT---TTTTT-----------TTTGGTTAATGGAACTTATAAGTATTATCGCCAAAACGTATATTTTGTACGACGGG------GGGAA--------AACGTTTATATTTGT---TAAATAGAAGTGGTGTCGCGGGCGCTCGCGAAAGTCGTGGAAACGAGAAAAGAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTACCGGCTTGAAACG---------GGGGACACACGGGTGAACAAAAGGGGGA-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATATATTTCGGTTGCG011100 Dieteria_canescens_1 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTCATATATGATTTTTTTTTT-ATTTTATTTTTTTAGTTAATGGAACTTATAAGTATTATCGCCAAAACGTATATTTTGTACGACGGG------GGGAA--------AACGTTTATATTTGT---TAAATAGAAGCGGTGTCGCAGGCGCTCGCGAAATTCGTGGAAACGAGAAAAGAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTACCGGCTTGAAACG---------GGCGACATACGGGTGAACAAAAGGGGGAGGAGGCTTCGTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATGTATTTCGGTTGCG011101 Dieteria_canescens_2 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTCATATATGATTTTTTTTTTTATTTTTATTTTTTAGTTAATGGAACTTATAAGTATTATCGCCAAAACGTATATTTTGTACGACGGG------GGGAA--------AACGTTTATATTTGT---TAAATAGAAGCGGTGTCGCAGGCGCTCGCGAAATTCGTGGAAACGAGAAAAGAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTACCGGCTTGAAACG---------GGCGACATACGGGTGAACAAAAGGGGGAGGGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATGTATTTCGGTTGCG011101 Dieteria_canescens_3 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCAAGGGTTGCTATTTTGGTTTGTTTCTTTTCATATATGATTTTTTTTTA---TTTTTTTTTTTAGTTAATGGAACTTATAAGTATTATCGCCAAAACGTATATTTTGTACGACGGG------GGGAA--------AACGTTTATATTTGT---TAAATAGAAGTGGTGTCGCAGGCGCTCGCGAAAGTCGTGGAAACGAGAAAAGAAGAAGACTGGCGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTACCGGCTTAAAACG---------GGCGACATACGGGTGAACAAAAGGGGGATGGGGCTTCCTGGGGAAAGGGATAAAAGAGTTAAGCAGAGGATGTATTTCGGTTGCG011101 Machaeranthera_tanacetifolia_1 TTGCAACCCTCTTTTTGTTTCC-GTAAATAGTTCTTCAGCCATGGGTTGGGCTTTTGGTTTATTTTTTTTTATTTTTTAT--------------------TTATGTGGACGGAATTTGTAATTATTACCGTCAAAACATATATTTTGTTTGACGGGGGGAGGAAACGTTTATTTATTTATTTATTTATTTATTTTAATAAAAGCGGCGTCGCAGGCGGTCGCGGAAGTGCGGGAAAGGAGAGAAGCAAAAGACGGACGGGCGCGGGGAGCT-CCGGGAATAAGTAAGACGTTCGGAGCGGTTGTCGGGTTGAAACGAGCCCGTGACGCGACGTACAGGTGAACAAATGGATGAGTAAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGAATGTATTTCGGTTGCG011111 Xanthisma_texanum_1 TTGCAACCCTCTTTTTGCTTTG-GTAATTCGTTTTTGAGTCGTGGGTCGCGCATTTGGTTTATTATTTTT--------GT--------------------TTGTGTGAAGGGACTTTATAATTAATACCGTAAAAACATATATTTTGTCTGACTGACGGGGGAA-CATAAAACGTTTAATTTTTTTTTTT---TTAATAAAAGCGGCGTCGCAGGCGGTCGCGGAAGTCCGGGAAACGAGGGAAGCAAAAGACGGACGGGCGGGGGGAGCGACCGGGACGAAACAAGACGTTCGGAGAGGTTGCCGGGTTGAAACGATCCCGCGAGGCGACGTACGGGTGAGCAAAAGGAGGAGGGAACTTCCTGGGATAAAGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG011111 Xylorhiza_wrightii_1 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCATGGGTTGCGATTTGGGTTTTTTTTTT-CG---TATAATT----------------TTTTTTTGTTAGTGGATTTTATAATTATTACCGTCAAAACATATAGTTTGCTTGACGGGTGGGGTGGGGGGGGGG-AGAACGTTTATCTTTGT---TAAATAAAAGCCGTGTCGCAGGCGCCCGCGAAAGACGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGACCGGGAAGAAGTAAGATGTTCGGTGAGGTTACCTGGTTGAAACGAGCCCGTGAGGCGACACA-GGGTGAACAAAAGGGGGAGGGAACTTCCTGGGGTAAGGGATAAAACCATTAAACAGAGGATGTATTTCGGTTGCG001011 Xylorhiza_wrightii_2 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCATGGGTTGCGATTTGGGTTTTTTTTTTTCG---TATAATT----------------TTTTTTTGTTAGTGGATTTTATAATTATTACCGTCAAAACATATAGTTTGCTTGACGGGTGGGGTGGGGGGGG-----AACGTTTATCTTTGT---TAAATAAAAGCCGTGTCGCAGGCGCCCGCGAAAGACGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGACCGGGAAGAAGTAAGACGTTCGGTGATGTTACCCGGTTGAAACGAGCCCGTGAGGCGACACA-GGGTGAACAAAAGGGGGAGGGAACTTCCTGGTGTAAGGGATAAAACCATTAAACAGAGGATGTATTTCGGTTGCG001011 Xylorhiza_wrightii_3 TTGCAACCCTCTTTTTGTTTTT-GTAATTCGTTTTTCAGCCATGGGTTGCGATTTGGGTTTTTTTTTT-CG---TATAATT----------------TTTTTTTGTTAGTGGATTTTATAATTATTACCGTCAAAACATATAGTTTGCTTGACGGGTGGCGTGGGGGGGGGGGAGAACGTTTATCTTTGT---TAAATAAAAGCCGTGTCGCAGGCGCCCGCGAAAGACGTGGAAACGAGAAAAGCAAAAGACTGACGGGCGCGGGGAGTGACCGGGAAGAAGTAAGATGTTCGGTGAGGTTACCCGGTTGAAACGAGCCCGTGAGGCGACACA-GGGTGAACAAAAAGGGGAGGGAACTTCCCGGGGTAAGGGATAAAACCATTAAACAGAGGATGTATTTCGGTTGCG001011 Xylorhiza_wrightii_4 TTGCAACCCTCTTTCAGTTTTC-ATAATTCATTTTTCAGCCGTGGGCTGCGATTTGTATTTGTTTCTTGTT---TAATAAT----------------TTTTTTTGTTAATGGACTTTATAATTATTACCGTCAAAAGATATGGTTTGCTTGACGGG------GGGAAGAA-----AACGTTTATCTTTGT---TAAATAAAAGCCGTGTCGCAGGCACCCGCGAAAGACGTGGAAACGAGAAAGGCAAAAGACTGACGGGCGCAGGGAGTGACCGGGAAGAAATAAGATGTTCGGTGAGGTTACCCGGTTGAAACGAGCCCGTGAGGCGACATA-GGGTGAACAAAAGGGGGAGGGAACTTCCTGGGGTAAGGGATAAAACCATTAAACAGAGGATGTTTTTCGGTTGCG001011 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4197] TITLE 5S_dataset_1; LINK TAXA = Taxa3; DIMENSIONS NCHAR=216; FORMAT DATATYPE=Standard SYMBOLS= "A C G T 0 1" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 ] [ . . . . . . . . . . . . . . . . . . . . . ] Arida_blepharophylla_1 TGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAA-GCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGATGTTCGAAGAGGTTAC-CGGGTTGAAAGGAGCCCGGGAGGCGACATAAGAGTGAACAAAAGGGGG-CGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTATTTCGGTTGCG111011011 Arida_blepharophylla_2 --TCGCACACGCTCGTGAAAGTCGGGGAAACGAGAATA-GCAGGAGACTGACGGGCGCGGGGAGTGACCGGGGCGGAATAAGTCGTTCGAAGAGGTTAT-CGGGTTGGAAGGAGCCCGCGAGGCGACATACGGGTGAACAAAAGGGGG-AGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_blepharophylla_3 TGTCGCAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAT-GCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGATGTTCGAAGAGGTTAC-CAGGTTGAAAGGAGCCCGGGAGGCGACATAAGAGTGAACAAAAGGGGG-AGGGGACTTCTTGGGGTAAGGGATAAAAGAATTAACAAGCGGATGTATTTCGGTTGCG111011011 Arida_blepharophylla_4 TGTCGTAGGCGCTCGCGAAAGTCGGGGAAACGAGAAAA-GCAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGGAGTAAGAAGTTCGAAGGGGTTAC-CGGGTTGAAAGGAGCCCGGGAGGCGACATAAGGGTGAACAAAAGGGGG-AGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAACAAGAGGATGTGTTTCGGTTGCG111011011 Arida_parviflora_124 TGTCGCAGGCGCTCGCGAAAGTCGAGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_parviflora_3 TGTCGCAGGAGCTCGCGAAAGTCGAGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_riparia_14 --------GCGCTCGCGGAAGCCGTGGAAACGAGAAAA-GCAAAGGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTAC-GGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_riparia_2 --------GCGCTCGCGGAAGCCGTGGAAACGAGAAAA-GCAAAGGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTAC-GAGCTTGAAACGGGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_riparia_3 --------GCGCTCGCGGAAGCCGTGGAAACGAGAAAA-GCAAAAGACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTAC-GGGCTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGGAGG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_turneri_12 TGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCCGTGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG111011011 Arida_turneri_3 TGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCCATGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG111011011 Corethrogyne_filaginifolia_1 -----------------------------------------------------------------------------------------------TTGC-GGGGTTGAAACGGGCGCGTGAGACGGCGTACGGGTGAGCAAACGGATG-AGGGAACTTCCTGGGTTGAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG111011011 Corethrogyne_filaginifolia_2 -----------------------------------------------------------------------------------------------TTGC-GGAGTTGAAACGGGCGCGTGAGACGGCGTACGGGTGAGCAAACGGATG-AGGGAACTTCCTGGGTTGAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Corethrogyne_filaginifolia_3 -----------------------------------------------------------------------------------------------TTGC-GGGGTTGAAACGGGCGCGTGAGACGGCGTACGGGTGAGCAAACGGATG-AGGGAACTTCCTGGGTTGATGGATAAAAGAATTAAACGAAGGACGTATTTCGGTTGCG111011011 Dieteria_bigelovii_1 TGTCGCAGGCGCTCGCGAAAGTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGGGACATACGGGTGAACAAAAGGGGG-A-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATGTATTTCGGTTGCG111010010 Dieteria_bigelovii_2 TGTCGCAGGCGCTCGCGAAAGTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGGGACATACGGGTGAACAAAAGGGGG-A-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCGGAGGATGTATTTCGGTTGCG111010010 Dieteria_bigelovii_3 TGTCGCGGGCGCTCGCGAAAGTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGGGACACACGGGTGAACAAAAGGGGG-A-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATATATTTCGGTTGCG111010010 Dieteria_canescens_1 TGTCGCAGGCGCTCGCGAAATTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGCGACATACGGGTGAACAAAAGGGGG-AGGAGGCTTCGTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATGTATTTCGGTTGCG111010011 Dieteria_canescens_2 TGTCGCAGGCGCTCGCGAAATTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGCGACATACGGGTGAACAAAAGGGGG-AGGGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGCAGAGGATGTATTTCGGTTGCG111010011 Dieteria_canescens_3 TGTCGCAGGCGCTCGCGAAAGTCGTGGAAACGAGAAAA-GAAGAAGACTGGCGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTAAAACG---------GGCGACATACGGGTGAACAAAAGGGGG-ATGGGGCTTCCTGGGGAAAGGGATAAAAGAGTTAAGCAGAGGATGTATTTCGGTTGCG111010011 Grindelia_ciliata_1 -------------------------------------------------AA-AGGCGGGGTGAGCGACCGGGACGTAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGAGGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGTAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111011011 Grindelia_ciliata_23 -------------------------------------------------AA-AGGCGGGGTGAGCGACCGGGACGTAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGTAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111011011 Haplopappus_glutinosus_1 CGTCGCAGGCGCTCGCGGAAGTCTGGGAGACTAGAAAC-GCCAAATACAGACGGCGGCGCGTAGCGACCGGGACGAAGGAAGACGTTCGGAGAGGTTGC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGTTTTGGGATAAAAGAACTAAACGAAGGATGTCTTTCGGTTGCG111011011 Haplopappus_glutinosus_2 CGTCGCAGGCGCTCGCGGAAGTCTGGGAGACTAGAAAC-GCCAAATACGGACGGCCGCGTGTAGCGACCGGGACGAAGGAAGACGTTCGGAGAGGTTGC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGTTTAGGGATAAAAGAACTAAACGAAGGATGTCTTTCGGTTGCG111011011 Haplopappus_glutinosus_3 CGTCGCAGGCGCTCGCGGAAGTCTGGGAGACTAGAAAC-GCCAAAGACGGACGGCCGCGGGTGGCGACCGGGACGAAGTCAGACGTTCGGAGAGGTTGC-GGGGTTGAAACGAGCCCGTGAGGCGTCGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGTTTAGGGATAAAAGAATTAAACGAAGGATGTCTTTCGGTTGCG111011011 Hazardia_squarrosa_1 CGCCGCAGGCGCTCGCGGAAGCCTGGGAGACGAGAAAA-GCCAAAGACGGACGGGCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGGGGTTAC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGTTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Hazardia_squarrosa_2 CGACGCAGGCGCTCGCGGAAGCCTGGGAGACGAGAAAA-GCCAAAGACGGACGGGCGCGTGGAGCGACCGGGATGAAGTAAGACGTTCGGAGGGGTTAC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGTTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Hazardia_squarrosa_3 CGACGCAGGCGCTTGCGGAAGTCTGGGAGACGAGAAAA-GCCAAAGACGGACGGGCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGGGGTTAC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAACGGATG-AGGGAACTTCCTGGGTTGAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Hazardia_squarrosa_4 CGACGCAGGCGCTCGCGGAAGCCTGGGAGACGAGAAAA-GCCAAAGACGGACGGGCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGGGGTTAC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGTTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Herrickia_kingii_1 -------GGCGCTCGCGAAATCCGGGGAAATGGGAAAA-GCAAGAGACGGACGGGCGCGTGGAGTGACCGAGACGAAGCAAGACGTTCGGAGAGGATAC-CGGGTTGAAACGAGCCCGTGAGGCGACATACGAGTGAACAAATGGAGG-AGGGAACTTCATGGGTGAAGGGATAAAAGAATTAAACAATGGATGAATTTTGGTTGCG111011011 Isocoma_veneta_1 CGTCGCAGGCGCTCGCGGAAGTCCTGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACCGGGACGAAGTAGGACGTTCGGAGAGGTTAC-GGG-CTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACCTCCTGGGAAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111001011 Isocoma_veneta_2 CGTCGCAGGCGCTCGCGGAAGTCCTGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACCGGGACGAAGTAGGACGTTCGGAGAGGTTAC-GGG-CTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACCTCCTGGGAAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111001011 Isocoma_veneta_3 CGTCGCAGGCGCTCGCGGAAGTCCTGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACCGGGACGAAGTAGGACGTTCGGAGAGGTTAC-GGG-CTGTAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACCTCCTGGGAAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111001011 Lessingia_glandulifera_1 -----------------------------------------------------------------------------------------------TTGC-GGGGCTAAAACGTGACCGCGAGACGACGTACGGGTGAGCAAATGGATG-AGGGGAGTCCGTGGGTTGAGGGCTAAAAGAATTAAGCGAAGGATGTATTTCGGTTGCG111011011 Lessingia_glandulifera_2 -----------------------------------------------------------------------------------------------TTGC-GGGGCTAAAACGTGACCGCGAGATGACGTACGGGTGAGCAAATGGATG-AGGGGAGTCCGTGGGTTGAGGGCTAAAAGAATTAAGCGAAGGATGTATTTTGGTTGCG111011011 Lessingia_glandulifera_3 -----------------------------------------------------------------------------------------------TTGC-GGGGCTAAAACGTGACCGCGAGACGACGTACGGGTGAGCAAATGGATG-AGGGAACTTCCTGGGTTGATGGATAAAAGAATTAAACGAAGGACGTATTTCGGTTGCG111011011 Machaeranthera_tanacetifolia_1 CGTCGCAGGCGGTCGCGGAAGTGCGGGAAAGGAGAGAA-GCAAAAGACGGACGGGCGCGGGGAGCTCC-GGGAATAAGTAAGACGTTCGGAGCGGTTGT-CGGGTTGAAACGAGCCCGTGACGCGACGTACAGGTGAACAAATGGATG-AGTAAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGAATGTATTTCGGTTGCG110011011 Machaeranthera_tanacetifolia_2 CGTCGCAGGCGGTCGCGGAAGTGCGGGAAAGGAGAGAA-GCAAAAGACGGACGGGCGCGGGGAGCTCC-GGGAAGAAGTAAGACGTTCGGAGCGGTTGT-CGGGTTGAAACGAGCCCGTGACGCGACGTACAGGTGAACAAATGGATG-AGGAAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGAATGTATTTCGGTTGCG110011011 Machaeranthera_tanacetifolia_3 CGTCGCAGGCGGTCGCGGAAGTGCAGGAAAGGAGAGAA-GCAAAAGACGGACGGGCGCGGGGAGCTCC-GGGAAGAAGTAAGACGTTCGGAGCGGTTGT-CGGGTTGAAACGAGCCCGTGACGCGACGTACAGGTGAACAAATGGATG-AGGAAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGAATGTATTTCGGTTGCG110011011 Oonopsis_engelmannii_1 TTTAGCAGGCGCGCGCGGAAGTGTGGGAAACGAGAGAA-GCAAAAGACGGAGGGGCGCGGGGAGCTTC-GGGAAGAAGTAAGACGTCCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGACGCACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTTGGTTGCG110011111 Oonopsis_engelmannii_2 CGACGCAGGCGCGCGCGGAAGTGTGGGAAACGAGAGAA-GCGAAAGACGGACGGGCGCGGGGAGCTTC-GGGGAGAAGTAAGACGTCCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG110011111 Oonopsis_engelmannii_3 CGACGCAGGCGCGCGCGGAAGTGTGGGAAACGAGAGAA-GCGAAAGACGGACGGGCGCGGGGAGCTTC-GGGGAGAAGTAAGACGTCCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG110011111 Oonopsis_wardii_1 CGACGCAGGCGCGCGCGGAAGTGTGGGAAACGAGAGAA-GCAAAAGACGGACAAGCGCGGGGAGCTTC-GGGAAGAAGTAAGACATTCGGAGAGGTTGT-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGAAAGTTCATGGGGTAAGGGATAAAAGAATTTAACAAAGGATGTATTTCGGTTGCG110011111 Oonopsis_wardii_2 AGACGCAGGCGCGCGCGGAAGTGCGGGAAACGAGAGGA-GCAAAAGACGGACGGGCGCGGGGAGCTTC-GGGAAGAGGTAAGACGTCCGGAGAGGTCGC-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG110011111 Oonopsis_wardii_3 CGACGCAGGCGCGCGCGGAAGTGCGGGAAACGAGAGGA-GCAAAAGACGGACGGGCGCGGGGAGATTC-GGGAAGAGGTAAGACGTCCGGAGAGGTCGC-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG110011111 Psilactis_brevilingulata_1 -------GGCGCTCGCGAAAGTCGGGGAAACGAGAAAA-GCAAAAGACGGGCGGGCGGGGGGAGTGACTGGGGTGAAGTAAGACGTTCGGAGAGGATAC-CGGGCTGAAACGAGCCAGTGAGGCGGCATACGGGTGAACAAATGGAGG-AGGGAAGTTCCTGGGGTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Pyrrocoma_crocea_1 AGGCGGCGGCGCTCGCGGAAGCCAGGGGGACGAGAAAAAGCAAAAGTCGGACGGGCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGCTAC-GGGGCTGAAACGGGCCCGTGAGGCGACGTACGGATGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTTCGGTTGCG111111011 Pyrrocoma_crocea_24 CGGCGGCGGCGCTCGCGGAAGCCAGGGGGACGAGAAAAAGCAAAAGTCGGACGGGCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGCTAC-GGGGCTGAAACGGGCCCGTGAGGCGACGTACGGATGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTTAGGTTGCG111111011 Pyrrocoma_crocea_3 CGTCGCCGGCGATCGCGGAAGTCCGGGAGACGAGAAAAACCAAAAGAGGGGCGGGCGCGGGGAGCGACCGGGACGAAGTACGACGTTCGGAGAGGTTAC-GGGGTTGAAACGGGCCCGTCAGGCGACGTACGGGTGAACAAATGGATG-AGGGGACTTCCTGGGGTAAGGGATAAAAGAATTAAGCGAGGGATGTATTTCGGTTGCG111111011 Pyrrocoma_lanceolata_1 CGGGGTCGGGGCTCGCGGAATCCAGGGGGAAGAGAAAAAGCAAAAGACGGACGGGCGCGGGGAGCGAACGGGACGAATTAAGACGTTTGGAGAGGCTAC-GGGGCAGAAACGGGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCCGGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTTCGGTTGCG111111011 Pyrrocoma_lanceolata_2 CGGGGTCGGGGCTCGCGGAAGCCAGGGGGAAGAGAAAAAGCAAAAGACGGACGGGCGCGGGGAGCGACCGGGACGAATTAAGACGTTCGGAGAGGCTAC-GGGGCAGAAACGGGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCCGGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTTCGGTTGCG111111011 Pyrrocoma_lanceolata_3 CGGCGGCGGCGCTCGCGGAAGCCAGGGGGACGAGAAAAAGCAAAAGTCGGACGGGCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGCTAC-GGGGCTGAAACGGGCCCGTGAGGCGACGTACGGATGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTTAGGTTGCG111111011 Pyrrocoma_lanceolata_4 CGGGGTCGGGGCTCGCGGAAGGCAGGGGGACGAGAAAAAGCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAATTAAGACGTTCGGAGAGGCTAC-GGGGCAGAAACGGGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTTCGGTTGCG111111011 Rayjacksonia_phyllocephala_123 --------------GCGGAAGTCCGGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACGGGGACGAAGGAGGACGTTCGGAGAGGTTAC-GGG-CTGAAACGAGGGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111001011 Symphyotrichum_drummondii_1 --------GCGCTCGCGAAAGTCTGGGAAACGAGAAAA-GCAAAAGACGGACGGGCGCGGGTAGTGACCGGGATGAAGTAATACGTTCGGAGAGGATAC-CGGGTTGAAACGAGCCAGTGAGGCGACATACGGGTGAACAAGTGGAGG-AGGGAGCTTCCTGGGGTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG111011011 Xanthisma_blephariphyllum_1 -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTCGAAACGGGCCCGTGAGGCGACGTACGGGTGAGCGGGTGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_blephariphyllum_2 -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAGCGGATGGACG-AGGAAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGCATGTATTTCGGTTGCG111011011 Xanthisma_blephariphyllum_3 -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACAGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGGAGGTATTTCGGTTGCG111011011 Xanthisma_coloradoense_1 -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTAAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGGATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_coloradoense_2 ---------------------------------------------------------------------GGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGGATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_coloradoense_3 -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACCGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGGATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_coloradoense_4 -----------------------------------------------------------GGCAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_crutchfieldii_1 CGTCGCAAGCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCCGGGGTAAGGTATAAAAGAATAAAACAAAAGATGTATTTCGGTTGCG111011011 Xanthisma_crutchfieldii_2 CGTCGTAGGCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_crutchfieldii_3 CGTCGCAGGCGCTCCCGGAAGTCTGGGAAACGAGAGAG-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGG-TGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGGTAAGGGATAAAATAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_gracile_1 CGCCGCGGACCCTCGCGGAAGTCCGGGAAAGGAGAGAA-GCAGAAGGCTGACG----------------------AAGTAAGACGTTCGGGGCGGTTTTACGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGACG-AGGGAACGTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG001011011 Xanthisma_gracile_2 CGTCGCGGGCCCTCGCGGAAGTCCGGGAAAGGAGAGAA-GCAGAAGGCGGACG----------------------AAGTAAGACGTTCGGGGCGGTTTTACGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGCACG-AGGGAACGTCCTGGGGTAAGGGATAAAAGAGTTAAACAAAGGGTGTATTTCGGTTGCG001011011 Xanthisma_gracile_3 CGTCGCGGGCCCTCGCGGAAGTCCGGGAAAGGAGAGAA-GCAGAAGGCGGACG----------------------AAGTAAGACGTTCGGGGCGGTTTTACGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGACG-AGGGAACGTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG001011011 Xanthisma_grindelioides_1 -----------------------------------------------------------GGGAAGGACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAAAGGATTGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGGATGTGTTTCGGTTGCG111011011 Xanthisma_grindelioides_24 -----------------------------------------------------------GGGAGCGACCGGGACGAAGTAAGATGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATTGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_grindelioides_3 -----------------------------------------------------------GGGAGCGACCGGGACGAAGTAAGACGTTAGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATTGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAGAATGTATTTCGATTGCG111011011 Xanthisma_gymnocephalum_1 -----------------------------------------------------------------------------------CGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGATTAAAACAAAGTATGTATTTCGGTTGCG111011011 Xanthisma_gymnocephalum_2 -----------------------------------------------------------------------------------CGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGGCG-AGGGAACTTCCTGGGGTAAGGGATAAAAGATTAAAACAAAGCATGTATTTCGGTTGCG111011011 Xanthisma_gymnocephalum_3 -----------------------------------------------------------------------------------CGTTCGGGGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGGCG-AGGGAACTTCCTGGGGTAAGGGATAAAAGATTAAAACAAAGCATGTATTTCGGTTGCG111011011 Xanthisma_rhizomatum_1 CGTCGCAGGCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGCAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGCACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_rhizomatum_2 CGTCGCAGGCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTGCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGCACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTTTGGTTGCG111011011 Xanthisma_rhizomatum_3 CGTCGCAGGCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCTGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGCACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_rhizomatum_4 CGTCGCACGCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTTTC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGCACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_spinulosum_1 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGGAGAGAA-GCTAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTAAAGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG011011011 Xanthisma_spinulosum_2 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGGAGAGAA-GCAAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTTAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG011011011 Xanthisma_spinulosum_3 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGTAGAGAA-GCAAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAACGGGTGTATTTCGGTTGCG011011011 Xanthisma_stenolobum_1 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGGAGAGAA-GTAAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG011011011 Xanthisma_stenolobum_2 CGTCGCGGGCGTTGGCGGAAGTCCGGGAAAGGAGAGAA-GCAAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGGCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGAGGTAAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG011011011 Xanthisma_stenolobum_3 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGGAGAGAA-GCAAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG011011011 Xanthisma_stenolobum_4 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGGAGAGAA-GCAAAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGT-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG011011011 Xanthisma_stenolobum_5 CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAGGAGAGAA-GCAAAAGGCGGACG-------------ACCGGGACGAAGTAAGAAGTTCGGAGAGGTTGC-CGGGCTGAAACGAGGCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGAGGTAAGGGATAAAAGAATTAAACAAAGGGTGTATTTCGGTTGCG011011011 Xanthisma_texanum_1 CGTCGCAGGCGGTCGCGGAAGTCCGGGAAACGAGGGAA-GCAAAAGACGGACGGGCGGGGGGAGCGACCGGGACGAAACAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGATCCCGCGAGGCGACGTACGGGTGAGCAAAAGGAGG-AGGGAACTTCCTGGGATAAAGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_texanum_2 CGTCGCAGGCGCTCGGGGAAGTCCGGGAAACGAGAGAA-GCAAAAGACGGACGGGCGAGGGGAGCGACCGGGACGAAATAAGACGTTCGGAGAGGTTGC-CGGGTTAAAACGATGCCGCGAGGCGACGTACGGGTGAGCAAAAGGAAA-AGGGAACTTCCTGAGGTAAAGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_texanum_3 CGTCGCAGGCGCTCGGGGAAGTCCGGGAAACGAGAGAA-GCAAAAGACGGACGGGCGAGGGGAGCGACCGGGACGAGATAAGACGTTCGGAGAGGTTGC-CGGGTTAAAACGATGCCGCGAGGCGACGTACGGGTGAGCAAAAGGAAA-AGGGAACTTCCTGAGGTAAAGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_viscdum_1 CGTCGCAGGCGCTCGCGGGAGTACGGGAAACGAGAGAA-GCAAAAGAGGGACGGGCGCGGGGAGCGACCGGGACGAGGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGAGGCACGGGTGAACAGATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthisma_viscdum_2 CGTCGCAGGCGCTCGCGGGAGTACGGGAAACGAGAGAA-GCAAAAGAGGGACGGGCGCGGGGAGCGACCGGGACGAGGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACAAGCCCGTGAGGCGAGGCACGGGTGAACAGATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTGCGGTTGCG111011011 Xanthisma_viscdum_345 CGTCGCAGGCGCTCGCGGGAGTACGGGAAACGAGAGAA-GCAAAAGAGGGACGGGCGCGGGGAGCGACCGGGACGAGGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGAGGCACGGGTGAACAGATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG111011011 Xanthocephalum_gymnospermoides_12 ----------------------------------AAAA-GCAAAAGACGGACGGGCGCGGGGAGCGACCGGGACGAAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGGACTTCCTGGGGAAATGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111011011 Xanthocephalum_gymnospermoides_3 ----------------------------------AAAA-GCAAAAGACGGACGGGCGCGGGGAGCGACCGGGACTAAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGGACTTCCTGGGGAAATGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG111011011 Xylorhiza_wrightii_1 TGTCGCAGGCGCCCGCGAAAGACGTGGAAACGAGAAAA-GCAAAAGACTGACGGGCGCGGGGAGTGACCGGGAAGAAGTAAGATGTTCGGTGAGGTTAC-CTGGTTGAAACGAGCCCGTGAGGCGACACA-GGGTGAACAAAAGGGGG-AGGGAACTTCCTGGGGTAAGGGATAAAACCATTAAACAGAGGATGTATTTCGGTTGCG111011001 Xylorhiza_wrightii_2 TGTCGCAGGCGCCCGCGAAAGACGTGGAAACGAGAAAA-GCAAAAGACTGACGGGCGCGGGGAGTGACCGGGAAGAAGTAAGACGTTCGGTGATGTTAC-CCGGTTGAAACGAGCCCGTGAGGCGACACA-GGGTGAACAAAAGGGGG-AGGGAACTTCCTGGTGTAAGGGATAAAACCATTAAACAGAGGATGTATTTCGGTTGCG111011001 Xylorhiza_wrightii_3 TGTCGCAGGCGCCCGCGAAAGACGTGGAAACGAGAAAA-GCAAAAGACTGACGGGCGCGGGGAGTGACCGGGAAGAAGTAAGATGTTCGGTGAGGTTAC-CCGGTTGAAACGAGCCCGTGAGGCGACACA-GGGTGAACAAAAAGGGG-AGGGAACTTCCCGGGGTAAGGGATAAAACCATTAAACAGAGGATGTATTTCGGTTGCG111011001 Xylorhiza_wrightii_4 TGTCGCAGGCACCCGCGAAAGACGTGGAAACGAGAAAG-GCAAAAGACTGACGGGCGCAGGGAGTGACCGGGAAGAAATAAGATGTTCGGTGAGGTTAC-CCGGTTGAAACGAGCCCGTGAGGCGACATA-GGGTGAACAAAAGGGGG-AGGGAACTTCCTGGGGTAAGGGATAAAACCATTAAACAGAGGATGTTTTTCGGTTGCG111011001 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4568] TITLE 5S_dataset_3; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1204; FORMAT DATATYPE=Standard SYMBOLS= "A C G T 0 1 2 3 4" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arida_blepharophylla TGTCG{CT}A{CG}{AG}CGCTCG{CT}GAAAGTCGGGGAAACGAGAA{AT}{AT}-GCAG{AG}AGACTGACGGGCGCGGGGAGTGACCGGG{AG}CGGA{AG}TAAG{AT}A{ACT}{GT}T{CT}GAAG{AG}GGTTA{CT}-C{AG}GGTTG{AG}AAGGAGCCCG{CG}GAGGCGACATA{AC}G{AG}GTGAACAAAAGGGGG-{AC}GGGGACTTC{CT}TGGGGTAAGGGATAAAAGAATTAA{AC}{AC}AG{AC}GGATGT{AG}TTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGTCCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAAATGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGATCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGGATGATTGGT-CGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCTTTAGACGACGCTTCGACCGC1111011001111GATTGTTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCAGCCTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACCGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATACGTGGGTTGGCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCACTTTT-CGTCTAGTGTTGCATCCG-CAACATTGGATGAACCGGGTAGCATTCTCTTTGATCCATGCAACT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCTCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATTCCTGTAGTGCCTTTATTGAGCGTTTTCGCTTCTCTTACACGACCGTCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT10100 Arida_parviflora TGTCGCAGG{AC}GCTCGCGAAAGTCGAGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCTGTGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGTGAACACGTTACAACAACCATGCCC--ATGGGTCGTGCATTTGTTCGATCCTAGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTGAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCATGGCTTCTTTATAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGAATGATTGGT-GGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTATCTTGTCAAAA-GGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1011011000111GATTGTTTGCTTGACTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCTTCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTTGGCTCCCTGCTTGAGCAGGCACGGCCACACGTGCATTCCTTTTCAGCTGTGCGACAAGGTATGTATCTTCTTGATCGTATAATTTGGTTTTCTGTGTTGCATACCTGATCAAAGGCATCGTTTTGATCAAAAGAATCCTTTTTTCGTCTAGTGTTGCATCTG-CACCATTGGATGAACCACGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTTGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTTCCTTGAATATGGAAGCCAAAATGGGCATGGGATTGCAAGATCCCTTTAGTGCCTTTATTGAGCGTTATCGCTTCTCTTACACGACCGCCTCTCACGTATGGCATGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Arida_riparia --------GCGCTCGCGGAAGCCGTGGAAACGAGAAAA-GCAAA{AG}GACTGACGGGCGCGGGGAGTGAGCGGGTCGAAGTAAGACGTCCGGAGAGGTTAC-G{AG}GCTTGAAACG{AG}GCCCGTGAGGCGACATACGGGTGAACAAAAGGAGG-AGGGAACTTCCTGGGGTAAGGGATAAAAGGATTAAACAGAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGTGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGTCCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACTGGATGTGCCAAGGAAA-TCTAAATTTAAGAAATGCATGTTCCATGATGTCCCGTTTACGGTGTGCTCATGGATCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGGATGATTGGTTCGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAAAGGGTGTATCTTAATAGACCCAATGTGTTGTCTTGAGACGACGCTTCGACCGC1111011011111GATTGTTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATATCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGACAAGGCTTGTATCGTCTTGATCGTATACGTGGGTTTGCTGTGCTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCACTTTT-CGTCTAGTGTTGCATCCG-CAACATTGGATGAACCGGGTAGCATTCTCTTTGATCCATGCAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATTCCTTTAGTGCCTTTATTGAGCGTTTTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT10100 Arida_turneri TGTCGCAGGCGTTCGCGAAAGTCGTGGAAACGAGAAAA-GAAAAAGACTGACGGGCGCGGGGAGTGACCGGGTCGAAGTAAGACGTCCGGAGCGGTTAC-CGGTTTGAAACGAGCCC{AG}TGAGGCGACATACGGGTGAACAAAAGTAGG-AGGGAACTTCCTGGGGTGAGGGATAAAAGAATTAAACAGAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGTGAACACGTTACAACAACTATGCCC--ATGGGTCGGGCATTTGTTCGATCCTAGTGGCACACCGTTGATGTGCGGCTTAGATGACCCTTT-GGGTAACTAGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTGAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTATAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGAATGATTGGT-GGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAAA-GGTGCATCTTAATAGACCCAACGCGTTGTCATGAGATGACGCTTCGACCGC1011011000111GATTGTTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGTCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGACCACGCGTGCATTCCTTTTCAGCTGTGCGACAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAAAGGCATCGTTTTGATCAAAAGAGTCCCTTTTTCGTCTAGTGTTGCATCTG-CACCATTGGATGAACCGCGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTTGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAATGGGCATGGGATTGCAAGATCCCTTTAGTGCCTTTATTGAGCGTTATCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Corethrogyne_filaginifolia -----------------------------------------------------------------------------------------------TTGC-GG{AG}GTTGAAACGGGCGCGTGAGACGGCGTACGGGTGAGCAAACGGATG-AGGGAACTTCCTGGGTTGA{GT}GGATAAAAGAATTAAAC{AG}AAGGA{CT}GTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCTTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTTTGGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGGTGTCCCGTTTGCGGTGTGCCCATGGAGCGTGGCTTCTTTCTAACAAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGGATGATTGGTTGTGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAGAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTATCTTGTCAAGAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111111011111GATTGCTTG?TTGGCTCTCTAGCCTAGTAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGATGTGCGGCAAGGCTTGTATGGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGAATACCTGATCAACGGCATCGTTTCGATCAAAAGCGTACCTTTTTCGTCTAGTGTTGCACCCG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACATAT-GACATTCATT-GTTAGTTGTTTGGCCCATTGA-GCGTGTCTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCACGGGATCGCAAGATCTGTTTAGTGCCCTAATTGAGCGTTTTCGCTTCTCTTACACGACTGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Dieteria_bigelovii TGTCGC{AG}GGCGCTCGCGAAAGTCGTGGAAACGAGAAAA-GAAGAAGACTGACGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTTGAAACG---------GGGGACA{CT}ACGGGTGAACAAAAGGGGG-A-GGGGCTTCCTGGGGAAAGGGATAAAAGAATTAAGC{AG}GAGGAT{AG}TATTTCGGTTGCG110100TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTATGCGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTTAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGATCGTGGCTTCTTTATAATCAATCGCGTCGCTCCC-TCCAAACCTCC-TTTGGGATGCTTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAAAATTCTGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCTTGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCAACAAGGCTTGTATCGTCTTGATTGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGGTTTGATCAAAAGCGTCACTTTT-CGTCTAGTGTTGCATCCG-CACCATTGGATGAACCATGTAGCATTCTCTTTGGTCCATACAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATTCCTTTAGTGCCTTTATTGAGCGTTTTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGATTGT10100 Dieteria_canescens TGTCGCAGGCGCTCGCGAAA{GT}TCGTGGAAACGAGAAAA-GAAGAAGACTG{AG}CGGGCGCGGGGAGTGACCGGGACGAAGTAAGACGTTCGGAGAGGTTAC-CGGCTT{AG}AAACG---------GGCGACATACGGGTGAACAAAAGGGGG-A{GT}GGGGCTTCCTGGGGAAAGGGATAAAAGA{AG}TTAAGCAGAGGATGTATTTCGGTTGCG110100TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTATGCGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTTAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGATCGTGGCTTCTTTATAATCAATCGCGTCGCTCCC-ACCAAACCTCC-TTTGGGATGCTTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAAAATTCTGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCTTGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTAT{CT}GTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGGTTTGATCAAAAGCGTCACTTTT-CGTCTAGTGTTGCATCCG-CACCATTGGATGAACCATGTAGCATTCTCTTTG{AG}TCCATACAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATTCCTTTAGTGCCTTTATTGAGCGTTTTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGATTGT10100 Grindelia_ciliata -------------------------------------------------AA-AGGCGGGGTGAGCGACCGGGACGTAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGA{CG}GTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGTAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGTTCGGGCATTTGTTCGATCCTCTTGGCATACCGTTGATGTGCGGTCTAGATGACCCTTT-GGGTTACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TATAAATTTAAGAATTGCCTGTTCCATG-TGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTATAATCAATCGCGTCGCTCCC-ACCAA---CCCCTTTGGGATGATTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTTTGTTGTGTGTCTTGTCAAGAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111000111111GATTGCTTGCTTGGCTTTCTAGCATTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGAACCTTTTTCGTCTAGTGTTGC-TTCGGCAGCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-AACGTTCATTCGTTGATCGTGTGGCCCATTGA-GGGTGACTTGGTCCCTTGAATACGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCGTTTGGTGCCCTTATTGAGCGTTCTTGCTTCTCTAACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11010 Haplopappus_glutinosus CGTCGCAGGCGCTCGCGGAAGTCTGGGAGACTAGAAAC-GCCAAA{GT}AC{AG}GACGGC{CG}GCG{CGT}GT{AG}GCGACCGGGACGAAG{GT}{AC}AGACGTTCGGAGAGGTTGC-GGGGTTGAAACGAGCCCGTGAGGCG{AT}CGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGTTT{AT}GGGATAAAAGAA{CT}TAAACGAAGGATGTCTTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGTCAGGATGGGTCGGGCATTTGTTCGATCCTCATGGCACACCGTTGATGTGCGGCCTAGACGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGGTGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGGATGATTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAGAGGGTGCATCTTAATAGACCCAATGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTCTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTGCCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATTGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTACCTTTTTCGTCTAGTGTTGCATCCG-CACCATTGGATGAACCGCGTAG-TTTCTCTTTGATCCATACAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATCGGATCGCAAGATCTGTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCATGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Hazardia_squarrosa CG{AC}CGCAGGCGCT{CT}GCGGAAG{CT}CTGGGAGACGAGAAAA-GCCAAAGACGGACGGGCGCG{GT}GGAGCGACCGGGA{CT}GAAGTAAGACGTTCGGAGGGGTTAC-GGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAA{CT}GGATG-{AG}GGGAACTTCCTGGGTT{AG}AGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCTTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGGTGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCATCC-TTTGGGATGATTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGGCTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCTTGTCAAGAGGGTGCATCTAAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTCTAGCCTTACAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAACGGCATCGTTTCGATCAAAAGCTTACCTTTTTCGTCTAGTGTTGCATCCG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCGTGTCTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATTCGTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACTGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Herrickia_kingii -------GGCGCTCGCGAAATCCGGGGAAATGGGAAAA-GCAAGAGACGGACGGGCGCGTGGAGTGACCGAGACGAAGCAAGACGTTCGGAGAGGATAC-CGGGTTGAAACGAGCCCGTGAGGCGACATACGAGTGAACAAATGGAGG-AGGGAACTTCATGGGTGAAGGGATAAAAGAATTAAACAATGGATGAATTTTGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCGTTTGTTTGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAATTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TTTAAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGGGCATGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCCATTTAGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTTACCGAGCGGTTGGCCAAAAAAAGAGTCCTTTTTGACGGGAACACGACTAGTGGTGGTTGACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGTGTTGTCATGAGACGACGCTTCGACCGC1111011111111GATTGCTTGCTTGGCTTTCTAGCCTTGCGGGTGGTTGATTGGCATTGCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATGGTTTTGATCAAAAGCATACCTTTTTCGTCTAGCGTTGCACCCG-CATCGTTGGAGGAGTCGAGCAGCATCCTTTTTGATCCATACAGTT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GGGTGGCTTGGTCTCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGTAAGATCCCTTTACTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTTTCATGTATGGCACGTCCCAACATGTTT-GGCTATGTCGAAGAGGAATGC11100 Isocoma_veneta CGTCGCAGGCGCTCGCGGAAGTCCTGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACCGGGACGAAGTAGGACGTTCGGAGAGGTTAC-GGG-CTG{AT}AACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACCTCCTGGGAAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110010TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCAGGCATTTGTTTGATCCTCTTGGCACACCGTTGATGTACGGCTTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACTCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGGTGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAA---TCCCTTCGGGTTGATTGTTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTACCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAGACGGTGCATCTTAATAGACCCAACGCGTTGTCTTATGATGACGCTTCGACCGC1111010111111GATTGCTTGCTTGGCTTTCTAGCCTTGCAGGTGGTTGATCGGCATTTCGGCTTCGGGGATGCCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAACGGCATCGTCTTGATCAAAAGTGTACCCTTTTCGTCTAGTGTTGCGTTCG-CATCATTGGATGAACCACGTAGCACTCTCTTTGATCCGTACAATC-AATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCGTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Lessingia_glandulifera -----------------------------------------------------------------------------------------------TTGC-GGGGCTAAAACGTGACCGCGAGA{CT}GACGTACGGGTGAGCAAATGGATG-AGGG{AG}A{CG}T{CT}C{CG}TGGGTTGA{GT}GG{AC}TAAAAGAATTAA{AG}CGAAGGA{CT}GTATTT{CT}GGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCTTGCCAAGATGGGTCGGGCATTTGTTCGATCCTCTTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTTTGGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTACATGGTGCCCCGTTTGCGGTGTGCCCATGGAGCGTGGCTTCTTTCTAACAAATCGCGTCGCTCAC-ACCAACCCTCC-TTTGGGATGATTGGTTGTGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAGAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTATAAAACCCAGAATTATGTTGTGTATCTTGTCAAGAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111111011111GATTGCTTGCTTGGCTCTTTAGCCTAGTAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATGGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAACGGCATCGTTTCGATCAAAAGCGTATCTTTTTCGTCTAGTGTTGCACCCG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATC-GACATTCATT-GTTAGTTGTTTGGCTCATTGA-GCGTGTCTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCACGGGATCGAAAGATCCGTTTAGTGCCCTAATTGAGCGTTTTCGCTTCTCTTACACGACTGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Machaeranthera_tanacetifolia CGTCGCAGGCGGTCGCGGAAGTGC{AG}GGAAAGGAGAGAA-GCAAAAGACGGACGGGCGCGGGGAGCTCC-GGGAA{GT}AAGTAAGACGTTCGGAGCGGTTGT-CGGGTTGAAACGAGCCCGTGACGCGACGTACAGGTGAACAAATGGATG-AG{GT}AAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGAATGTATTTCGGTTGCG100110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAAC-ATGCCATGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACAACGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTCGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTTGGGATGATTGGTT-GGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAAAATTATGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTTTAGCCTTTTAGGTGGTTGATTGGCATTTTGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGACTACCTGATCAATGGCATTGTTTTGATCCAAATCATACCTTTTTCGTCTAGTGTTGCATCCG-CACCATTGGATGAACCGGGTAGCACTCTCTTTGATCCATACAATT-GATGGTCATT{CT}GTTGATTGTATGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCCTTTAGTGTCCTTACTGAGCGTTATCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Oonopsis_engelmannii CGACGCAGGCGCGCGCGGAAGTGTGGGAAACGAGAGAA-GCGAAAGACGGACGGGCGCGGGGAGCTTC-GGGGAGAAGTAAGACGTCCGGAGAGGTTGC-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGGGAAGTTCATGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG100111TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCATGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATAACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCATGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTCGGGATGATTGGTTGGGGGCGGATAATGGTCTCCCGTTTTTCACCAAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAAATGGTACATCTTA-TAGACCCAATGCGTTGTCACTAGACGACGCTTCGACCGC1111011011101GATTGCTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTCGATCCAAAGTGTGCCTTTTTCGTCTAGTGTTGCATCAG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTCGTTGATTGTTTGG{CT}CCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAATGGGCATGGGATCGCAAGGTCCCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Oonopsis_wardii {AC}GACGCAGGCGCGCGCGGAAGTG{CT}GGGAAACGAGAGGA-GCAAAAGACGGAC{AG}{AG}GCGCGGGGAG{AC}TTC-GGGAAGA{AG}GTAAGAC{AG}T{CT}CGGAGAGGT{CT}G{CT}-CGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATGGAGG{AG}AAGTTCATGGGGTAAGGGATAAAAGAATT{AT}AACAAAGGATGTATTTCGGTTGCG100111TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCATGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATAACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATCGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCATGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCCTCC-TTCGGGATGATTGGTTGGGGGCGGATAATGGTCTCCCGTTTTTCACCAAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAAATGGTACATCTTA-TAGACCCAATGCGTTGTCACTAGACGACGCTTCGACCGC1111011011101GATTGCTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTTGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTCGATCCAAAGTGTGTCTTTTTCGTCTAGTGTTGCATCAG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GAGTGACTTGGTCCCTTGAATATGGAAGCCAAAATGGGCATGGGATCGCAAGATCCCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Psilactis_brevilingulata -------GGCGCTCGCGAAAGTCGGGGAAACGAGAAAA-GCAAAAGACGGGCGGGCGGGGGGAGTGACTGGGGTGAAGTAAGACGTTCGGAGAGGATAC-CGGGCTGAAACGAGCCAGTGAGGCGGCATACGGGTGAACAAATGGAGG-AGGGAAGTTCCTGGGGTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCA-AACAACCCGCGAACATGTTACAACAACCTTGCCATGATGGGTCGGGCTTTTGTTTGATCCTCATGGCACACCGTTGATGTGCGGCCTAT-TGACCCTTT-GGGTCTTTGGTTGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-CTTAAATTTAAGAATTGCCTCCTCCATGATGTCCCGTTTGCGGTGTGCTCATGGGGTGTGGCTTCTTTATAATCAATCGCGTCGCTCCC-ACCAACCCTCCCTTTGGGATGATTGGTTTGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTGACAAAACCCAGAATTCTGTTGTGTATCTTGTCAAGATGGTGCATCTTAATAGACCCAACGCGTTGTCATG-----ACGCTTCGACCGC0110011111110GATTGCTTGCTTCGCTTTTTAGCCTGGCGGGTGGTTGACTGGCATTTCGGCTTCGATGGTGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGACCACGCGTGCATTCCTTTTCAGTTGGGCGGCAAGGCTTGTATTGTCTTGATCGTTTATGTGGGTTTCATGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCTTCCCTTTT-CGTCTCACGTTGCACCCG-CATCGTTGGATGATTCACGTAGCATCATCTTTGATCCATGCAGTT-GATGTGAATTCGTTGACTGATTGGCCCATTGA-TGGTGGCTTGGTCTCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCTTTTACTGCCTTTTTTGAGCGTTCTCGCTTCTCTTAAACGACTGCCTTTCACGTATGGCACGTCCCAACGTGTTTTGGCTATGTCGAAGAGGAATGT10101 Pyrrocoma_crocea CG{GT}CG{CG}CGGCG{AC}TCGCGGAAG{CT}C{AC}GGGAGACGAGAAAAA{CG}CAAAAG{AT}{CG}GGGCGGGCGCGGGGAGCGACCGGGACGAAGTA{AC}GACGTTCGGAGAGG{CT}TAC-GGGG{CT}TGAAACGGGCCCGT{CG}AGGCGACGTACGGGTGAACAAATGGATG-AGGGGACTTCCTGGGGTAAGGGATAAAAG{AG}ATTAA{AG}CGAGGGATGTATTT{AC}GGTTGCG111110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCTTGGCACACCGTTGATGTGCGTCCTAGATGACCCTAT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGAATGTGCCAAGGAAA-TATAAATTTAAGAATTGCCTGTTCCATGGTGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCTTCC-TTTGGGATGATTGGTTGTGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAGAGGGTACATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGTTTGCTTGGCTTTCTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTGTTGATCAAAACTGAACCTTTTTCGTCTAATGTTGCATCCG-CATCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATCCAATT-AATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCGAAGTGGGCATGGGATCGCAAGATCCGTTTAGTGCCCTTATTGAGCGTTATCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Pyrrocoma_lanceolata CGG{CG}G{GT}CGG{CG}GCTCGCGGAA{GT}{CG}CAGGGGGA{AC}GAGAAAAAGCAAAAG{AT}CGGACGGCCGCGGGGAGCGA{AC}CGGGACGAA{GT}TAAGACGTT{CT}GGAGAGGCTAC-GGGGC{AT}GAAACGGGCCCGTGAGGCGACGTACGG{AG}TGAACAAATGGATG-AGGGAACTTCC{CT}GGGGTAAGGGATAAAAGGATTAAACGAGGGATGTATTT{AC}GGTTGCG111110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCTTGGCACACCGTTGATGTGCGTCCTAGATGACCCTAT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGAATGTGCCAAGGAAA-TATAAATTTAAGAATTGCCTGTTCCATGGTGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAACCTTCC-TTTGGGATGATTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCTTGTCAAGAGGGTACATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGTTTGCTTGGCTTTCTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTCCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTCTTGATCAAAACTGTACCTTTTTCGTCTAGTGTTGCATCCG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATCCAATT-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCGTTTAGTGCCCTTATTGAGCGTTATCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Rayjacksonia_phyllocephala --------------GCGGAAGTCCGGGAGACGAGAAAA-GCAAAAGACGGACGGGCGCGGGGAGGTACGGGGACGAAGGAGGACGTTCGGAGAGGTTAC-GGG-CTGAAACGAGGGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGAACTTCCTGGGGAAAGGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110010TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGTGCATTTGTTCGATCCTCTTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGCTGCATTGACGTAACAAAACTCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGTAGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAA---TCCCTTCGGGATGATTGTTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTCTTGTCAAGAGGGTGCATCTTAATAGACCCAGCGCGTTGTCTTGAGATGACGCTTCGACCGC1111010111111GATTGTTTGCTTGGCTTTCTAGCCTCGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGCCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGATGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTCTTGATCAAAAGCGTACCTTTTTCGTCTAGTGTTGCATTCG-CATCATTGGACGAACCACGTAGCATTCTCTTTGATCCATACAAAC-GATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCTGTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Symphyotrichum_drummondii -------G-CGCTCGCGAAAGTCTGGGAAACGAGAAAA-GCAAAAGACGGACGGGCGCGGGTAGTGACCGGGATGAAGTAATACGTTCGGAGAGGATAC-CGGGTTGAAACGAGCCAGTGAGGCGACATACGGGTGAACAAGTGGAGG-AGGGAGCTTCCTGGGGTAAGGGATAAAAGAATTAAACGAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCA-AACGACCCGCGAACATGTTACAACAACCTTGCCATGATGGGTCGAGCTTT-GTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAT-TGACCCTTT-GGGTCTTTGGTTGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-CTTAAATTTAAGAATTGCCTCCTCCATGATGTCCCGTTCGCGGTGTGCTCATGGGGCGTGGCTTCTTTATAATCAATCGCGTCGCTCCC-ACCAACCCTCCCTTTGGGATGATTGGTTTGGGGCGGATATTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTGACAAAACCCAGAATTCTGTTGTGTATCTTGTCAAGATGGTGCATCTTAATAGACCCAACGCGTTGTCATG-----ACGCTTCGACCGC0100011111110GATTGCTTGCTTCGCTTTTTAGCATTGCGGGTGGTTGATCGGCATTTCGACTTCGGGAATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGTTGGGCGACAAGGCTTGTATCGTCTTGATCGTTTAAGTGGGTTTCATGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAG-TTGCCTTTGTCGTCCGACGTTGCACCCG-CATCGTTGGATGATTCATGTAGCATCATCTTTGATCCATGCAGTT-GATGTTAATTCGTTGACTGTTTGGCCCATTGA-TGGTGGCTTGGTCTCTCGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCTCTTACTGCCCTTCCTGAGCGTTTTCGCTTCTCTTAAACGACTGCCTTTCACGTATGGCACGTCCCAGCGTGTTTTGGCTATGTCGAAGAGGAATGT01101 Xanthisma_blephariphylla -----------------------------------------------------------GGGAGCGACGGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGT{CT}GAAACGGGCCCGTGAGGCGACGTACGGGTGA{AG}C{AG}G{AG}TGGACG-AGG{AG}AACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAG{CG}A{GT}GTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTAGTTCGATCCTCGTGGCACACCGTTGATGTGCGTCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TTTCGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCATGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGTTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTTGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCATGCGTACATTCCTTTTCAATTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATTCG-CATCATTGGATGAACCCCGTAGCATTCTCTTTGATCCATACAATT-TATGTTCAGTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCTTTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGCGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_coloradoense -----------------------------------------------------------GG{CG}AGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTT{AG}C-CGGGTTGAAAC{CG}GGCCCGT{AG}AGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCCTGGGATAAGGGATAAAAG{AG}ATAAAACAAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTAGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TTTCGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCATGTCAAAAGGGTGCACCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTTTAGCATTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGTTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCATGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATCCG-CATCATTGGATGAACCGGGTAGCATTCTCTTTGATCCATACAATT-GATGTTCAGTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCTCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTACGTCGAAGAGGAATGT11100 Xanthisma_crutchfieldii CGTCG{CT}AGGCGCTCCCGGAAGTCTGGGAAACGAGAGA{AG}-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGGACG-AGGGAACTTCC{CT}GGGGTAAGG{GT}ATAAAA{GT}AATAAAACAAA{AG}GATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAATAACCATGCCAGGATGGGTCGGGCATTAGTTCGATCCTCGTGGCATACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGATGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAAACATTC-TTTCGAATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCATGTCAAAAAG-TGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011011TTTTGCTTGCATGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAATTGTGCGGCAAGGCTTGTATCGCCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATCCG-CATCATTGGATGAACCGAGTAGCATTCTCTTTGATCCATACAATT-GATGTTCAGTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCTAAAGTGGGCATGGGATCGCAAGATCTCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_gracile CG{CT}CGCGG{AG}CCCTCGCGGAAGTCCGGGAAAGGAGAGAA-GCAGAAGGC{GT}GACG----------------------AAGTAAGACGTTCGGGGCGGTTTTACGGGTTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATG{CG}ACG-AGGGAACGTCCTGGGGTAAGGGATAAAAGA{AG}TTAAACAAAGGGTGTATTTCGGTTGCG010110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TATAAATTTAAGAATTGCCCGTTCCATGATGTCCCGTTTGCGGTGTACTCATGGAGCGTGGTTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TTTGGAATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCCTGTGATGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCGTTTTACCCTTGCAGGTGGTTGATTGGCATTCCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGT-GTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCCTTCCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATTTG-CATCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATC-GACGTTCATTCATTGATTGTTTGGCCCTTTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATTGCAAGATCCCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_grindelioides -----------------------------------------------------------GGGA{AG}{CG}GACCGGGACGAAGTAAGA{CT}GTT{AC}GGAGAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAA{AC}GGATTGACG-AGGGAACTTCCTGGGATAAGGGATAAAAGAATAAAACAAAG{AG}ATGTATTTCGATTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTAGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TTTCGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCATGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGTTTGCTTGGCTTTTTAGCATTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGTTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCATGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATCCG-CATCATTGGATGAACCGGGTAGCATTCTCTTTGATCCATACAATT-GATGTTCAGTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCTCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_gymnocephalum -----------------------------------------------------------------------------------CGTTCGG{AG}GAGGTTGC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGG{AG}CG-AGGGAACTTCCTGGGGTAAGGGATAAAAGATTAAAACAAAG{CT}ATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGTGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTAGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCTTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCTAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAAACCTTC-TTTCGAATGATTGGTTGGGAGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCATGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAATTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCGTTTTCGTCTTGTGTTGCATCCG-CATCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTTGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCTCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_rhizomatum CGTCGCA{CG}GCGCTCCCGGAAGTCTGGGAAACGAGAGAA-GCAAAAGACGGACGGCCGCGGGGAGCGACCGGGACGAAGTAAGACGTTC{GT}{CG}AGAGGTTTC-CGGGTTGAAACGGGCCCGTGAGGCGACGTACGGGTGAACGGATGCACG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATAAAACAAAGGATGTATTT{CT}GGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTAGTTCGATCCTCGTGGCATACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGATGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAAACCTTC-TTTCGAATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACAGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCATGTCAAAAAG-TGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011011TTTTGCTTGCATGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAATTGTGCGGCAAGGCTTGTATCGCCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATCCG-CATCATTGGATGAACCGAGTAGCATTCTCTTTGATCCATACAATT-GATGTTCAGTCGTTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCTAAAGTGGGCATGGGATCGCAAGATCTCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_spinulosum CGTCGCGGGCGCTGGCGGAAGTCCGGGAAAG{GT}AGAGAA-GC{AT}AAAGGCGGACG-------------ACCGGGACGAAGTAAGACGTTCGGAGAGGTTGC-CGGGCTGAAACGAGCCCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTGGGGT{AT}AGGGATAAAAGAATTAAACAA{AC}GGGTGTATTTCGGTTGCG010110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAAATATAAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACACTTC-TTTGGAATGATTGGTTGGGAGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAAAATTATGTTGTGTGTCTTGTCAAAAGGATGCATCTTAATAGACCCAACGCGTTGTCTTGCGATGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCGTTTTACCCTTGCAGGTGGTTGATTGGCATTCCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGTTGTGCGGCAAGGCTTGTATCATCTTGATCGTATAAGTGGGTTTCCTGTGTTGCCTACCTGATCAATGGCATCGTCTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATATG-CATCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTCATTGATTGTTTGGCTCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCCTTTAGTGCCCTTATTGAGCGTTTTCGCTTCTCTTACACGACCGTCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_stenolobum CGTCGCGGGCG{CT}TGGCGGAAGTCCGGGAAAGGAGAGAA-G{CT}AAAAGGCGGACG-------------ACCGGGACGAAGTAAGA{AC}GTTCGGAGAGGTTG{CT}-CGGGCTGAAACGAG{CG}CCGTGAGGCGACGTACGGGTGAACAAATGGATG-AGGGAACTTCCTG{AG}GGTAAGGGATAAAAGAATTAAACAAAGG{AG}TGTATTTCGGTTGCG010110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAAGTATAAATTTAAGAATTGCCTGTTCCATGATGACCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TTTGGAATGATTGGTTGGGAGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAAAATTATGTTGTGTGTCTTGTCATAAGGGTGCATCTTAATAGACCCAACGCGTTGTCTTGCGATGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCGTTTTACCCTTGCAGGTGGTTGATTGGCATTCCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGTTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCCTACCTGATCAATGGCATCGTCTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATATG-CAGCATTGGATGAACCGAGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTCATTGATTGTTTGGCTCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCCTTTAGTGCCCTTATTGAGCGTTTTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_texanum CGTCGCAGGCGCTCG{CG}GGAAGTCCGGGAAACGAG{AG}GAA-GCAAAAGACGGACGGGCG{AG}GGGGAGCGACCGGGACGA{AG}A{CT}AAGACGTTCGGAGAGGTTGC-CGGGTT{AG}AAACGAT{CG}CCGCGAGGCGACGTACGGGTGAGCAAAAGGA{AG}{AG}-AGGGAACTTCCTG{AG}G{AG}TAAAGGATAAAAGAATTAAACAAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCTTTTGTTCGACCCTCGTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAA--TCTAAATTTAAGAATTGCCAGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TT-GGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAATATGAGTCCCTTTTGATGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTCGCTTGGCTTTTTAGCCTTGCTGGTGGTTGTTTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGTTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGCTTTGATCAAAAGACTCCCTTTTTCGTCTAGTGTTGCATCCG-CATCATTGGATGGACCGCGTAGCATTCTCTTTGATCCATACAGTT-GATGTTCATTCATTGATTGTTTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCCTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthisma_viscidum CGTCGCAGGCGCTCGCGGGAGTACGGGAAACGAGAGAA-GCAAAAGAGGGACGGGCGCGGGGAGCGACCGGGACGAGGTAAGACGTTCGGAGAGGTTGC-CGGGTTGAAAC{AG}AGCCCGTGAGGCGAGGCACGGGTGAACAGATGGATG-AGGGAACTTCCTGGGGTAAGGGATAAAAGAATTAAACAAAGGATGTATT{GT}CGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCGAATGGCGCACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATGAACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCAAAAATTAAGAATTGCCTGTTTCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTACTAATCAATCGCGTCGCTCCC-ACCAACCCTTC-TTTGGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCTAGCGGTTGGCCAAAA-AATAGTCCCTTTTGATGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTATGTTGTGTGTCTTGTCAAAAGGGTGAATGTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTGTTTAGCCTTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTACATTCCTTTTCAGTCGCGCGGCAAGGCTTGTATCGTCTTGATCGTATTAGTGGGTTTCCTGTGTTGCCTACCTGATCAATGGCATCGTCTTGATCAAA-GCGTCCCTTTTTCGTCTAGTGTTGCATCCG-CATCATTCGATGAACCGCGTAGCATTCTCTTTGATCCAAACAATTTGATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCATGACTTGGTCCCTTGAATATGGAAGCCAAGGTGGGCATGGGATCGCAAGATCCTTTTAGTGCCCGTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xanthocephalum_gymnospermoides ----------------------------------AAAA-GCAAAAGACGGACGGGCGCGGGGAGCGACCGGGAC{GT}AAGTAGGACGTTCGGAGAGGTTAC-GGGGCTGAAACGAGCGCGTGGGGCGACGTACGGGTGAACAAATGGATG-GGGGGACTTCCTGGGGAAATGGTTAAAAGCATTAAACGAAGGATGTATTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCCTGGCACACCGTTGATGTGCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCATTGACGTAACAAAACTCCGGCACGGGATGTGCCAAGGAAA-TGTAAATTTAAGAATTGCCTGTTCCATGGTGCCCCGTTTGCGGTGTGCTCATGGAGCGTGGCTTCTTTCTAATCAATCGCGTCGCTCCC-ACCAA---TCCCTTCGGGATGATTGGTTGGGGGCGGATATTGGTCTCCCGTTTTTCACTGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGACGGGAACACGACTAGTGGTGGTTTACAAAACCCAGAATTCTGTTGTGTGTTTTGTCAAGAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGATGACGCTTCGACCGC1111010111111GATTGCTTGCTTGGCTTTCTAGC-TTGCAGGTGGTTGATTGGCATTTCGGCTTCGGGGATGCCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATTAATGCCATCGTCTTGATCAAAAACGTACCTTTTTCGTCTAGTGTTGCATTCG-CATCATTGGATGAACCACGTAGCATTCTCTTTGATCCATACAATC-AATGTTCATTCGTTGATTGTTTGGCCCATTGA-GCTTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATTGCAAGATCCGTTTAGTGCCCTTATTGAGCGTTCTCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 Xylorhiza_wrightii TGTCGCAGGC{AG}CCCGCGAAAGACGTGGAAACGAGAAA{AG}-GCAAAAGACTGACGGGCGC{AG}GGGAGTGACCGGGAAGAA{AG}TAAGA{CT}GTTCGGTGA{GT}GTTAC-C{CT}GGTTGAAACGAGCCCGTGAGGCGACA{CT}A-GGGTGAACAAAA{AG}GGGG-AGGGAACTTCC{CT}GG{GT}GTAAGGGATAAAACCATTAAACAGAGGATGT{AT}TTTCGGTTGCG110110TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACCGTTGATGTCCGGCCTAGATGACCCTTT-GGGTAACTGGTCGTTGCGTTGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAA-TCTAAATTTAAGAATTGCCTGTTCCATGATGTCCCGTTTGCGGTGTGCTCATGGAGCGCGGCTTCTTTCTAATCAATCGCGTCGCTCCCAACCAACCCTTC-TTCGGGATGATTGGTTGGGGGCGGATACTGGTCTCCCGTTTTTCACCGAGCGGTTGGCCAAAAAAAGAGTCCCTTTTGATGGGAACACGACTAGTGGTGGTTTACAAAACCTAGAATTTTGTTGTGTGTCTTGTCAAAAGGGTGCATCTTAATAGACCCAACGCGTTGTCATGAGACGACGCTTCGACCGC1111011011111GATTGCTTGCTTGGCTTTTTAGCCTTGCAGGTGGTTGATTGGCGTTTCGGCTTCGGGGATGTCTACCGTAAAGGTGCATGAGTGGTGTTTGGTTTGATACGGGTGGTCGGCTCCCTGCTTGAGCAGGCACGGCCACGCGTGCATTCCTTTTCAGCTGTGCGGCAAGGCTTGTATCGTCTTGATCGTATAAGTGGGTTTCCTGTGTTGCATACCTGATCAATGGCATCGTTTTGATCAAAAGCGTCCCTTTTTCGTCTAGTGTTGCATCCG-CACCATTGGATGAACCGTGTAGCATTCTCTTTGATCCATACAATT-GATGTTCATTCATTGATTGCGTGGCCCATTGA-GCGTGACTTGGTCCCTTGAATATGGAAGCCAAAGTGGGCATGGGATCGCAAGATCCCTTTAGTGCCTTTATCGAGCGTTATCGCTTCTCTTACACGACCGCCTCTCACGTATGGCACGTCCCAGCGTGTTT-GGCTATGTCGAAGAGGAATGT11100 ; END; BEGIN TREES; TITLE Tb10298; LINK TAXA = Taxa3; TRANSLATE 1 Psilactis_brevilingulata_1, 2 Symphyotrichum_drummondii_1, 3 Herrickia_kingii_1, 4 Xylorhiza_wrightii_1, 5 Xylorhiza_wrightii_2, 6 Xylorhiza_wrightii_3, 7 Xylorhiza_wrightii_4, 8 Arida_riparia_14, 9 Arida_riparia_2, 10 Arida_riparia_3, 11 Arida_blepharophylla_1, 12 Arida_blepharophylla_2, 13 Arida_blepharophylla_3, 14 Arida_blepharophylla_4, 15 Arida_turneri_12, 16 Arida_turneri_3, 17 Arida_parviflora_124, 18 Arida_parviflora_3, 19 Dieteria_canescens_1, 20 Dieteria_canescens_2, 21 Dieteria_canescens_3, 22 Dieteria_bigelovii_1, 23 Dieteria_bigelovii_2, 24 Dieteria_bigelovii_3, 25 Xanthisma_texanum_1, 26 Xanthisma_texanum_2, 27 Xanthisma_texanum_3, 28 Xanthisma_rhizomatum_1, 29 Xanthisma_rhizomatum_2, 30 Xanthisma_rhizomatum_3, 31 Xanthisma_rhizomatum_4, 32 Xanthisma_crutchfieldii_1, 33 Xanthisma_crutchfieldii_2, 34 Xanthisma_crutchfieldii_3, 35 Xanthisma_gymnocephalum_1, 36 Xanthisma_gymnocephalum_2, 37 Xanthisma_gymnocephalum_3, 38 Xanthisma_coloradoense_1, 39 Xanthisma_coloradoense_2, 40 Xanthisma_coloradoense_3, 41 Xanthisma_coloradoense_4, 42 Xanthisma_grindelioides_1, 43 Xanthisma_grindelioides_24, 44 Xanthisma_grindelioides_3, 45 Xanthisma_blephariphyllum_1, 46 Xanthisma_blephariphyllum_2, 47 Xanthisma_blephariphyllum_3, 48 Xanthisma_viscdum_1, 49 Xanthisma_viscdum_2, 50 Xanthisma_viscdum_345, 51 Xanthisma_spinulosum_1, 52 Xanthisma_spinulosum_2, 53 Xanthisma_spinulosum_3, 54 Xanthisma_stenolobum_1, 55 Xanthisma_stenolobum_2, 56 Xanthisma_stenolobum_3, 57 Xanthisma_stenolobum_4, 58 Xanthisma_stenolobum_5, 59 Xanthisma_gracile_1, 60 Xanthisma_gracile_2, 61 Xanthisma_gracile_3, 62 Machaeranthera_tanacetifolia_1, 63 Machaeranthera_tanacetifolia_2, 64 Machaeranthera_tanacetifolia_3, 65 Oonopsis_wardii_1, 66 Oonopsis_wardii_2, 67 Oonopsis_wardii_3, 68 Oonopsis_engelmannii_1, 69 Oonopsis_engelmannii_2, 70 Oonopsis_engelmannii_3, 71 Haplopappus_glutinosus_1, 72 Haplopappus_glutinosus_2, 73 Haplopappus_glutinosus_3, 74 Corethrogyne_filaginifolia_1, 75 Corethrogyne_filaginifolia_2, 76 Corethrogyne_filaginifolia_3, 77 Lessingia_glandulifera_1, 78 Lessingia_glandulifera_2, 79 Lessingia_glandulifera_3, 80 Hazardia_squarrosa_1, 81 Hazardia_squarrosa_2, 82 Hazardia_squarrosa_3, 83 Hazardia_squarrosa_4, 84 Pyrrocoma_crocea_1, 85 Pyrrocoma_crocea_24, 86 Pyrrocoma_crocea_3, 87 Pyrrocoma_lanceolata_1, 88 Pyrrocoma_lanceolata_2, 89 Pyrrocoma_lanceolata_3, 90 Pyrrocoma_lanceolata_4, 91 Xanthocephalum_gymnospermoides_12, 92 Xanthocephalum_gymnospermoides_3, 93 Grindelia_ciliata_1, 94 Grindelia_ciliata_23, 95 Rayjacksonia_phyllocephala_123, 96 Isocoma_veneta_1, 97 Isocoma_veneta_2, 98 Isocoma_veneta_3; TREE Fig._1 = [&R] ((1,2),3,((((((4,6),7),5),((((11,13),14),12),((19,20),(21,(22,23,24))))),(((8,9),10),((15,16),(17,18)))),(((25,(26,27)),(((((28,29,30,31),32,(33,(35,(36,37))),34),(((38,39,40),(45,46),47),41,(42,43,44))),(48,49,50)),((((51,52,53,54,(55,58),56),57),(59,60,61)),((62,63,64),(65,(((66,67),(69,70)),68)))))),(((((71,72),73),((74,75,76),((77,78),79))),((80,81,83),82)),((((84,(85,89)),((87,88),90)),86),(((91,92),(95,(96,97,98))),(93,94))))))); END; BEGIN TREES; TITLE Tb10299; LINK TAXA = Taxa1; TRANSLATE 1 Psilactis_brevilingulata, 2 Symphyotrichum_drummondii, 3 Herrickia_kingii, 4 Xylorhiza_wrightii, 5 Arida_riparia, 6 Arida_blepharophylla, 7 Arida_turneri, 8 Arida_parviflora, 9 Dieteria_canescens, 10 Dieteria_bigelovii, 11 Xanthisma_texanum, 12 Xanthisma_rhizomatum, 13 Xanthisma_crutchfieldii, 14 Xanthisma_gymnocephalum, 15 Xanthisma_coloradoense, 16 Xanthisma_grindelioides, 17 Xanthisma_blephariphylla, 18 Xanthisma_viscidum, 19 Xanthisma_spinulosum, 20 Xanthisma_stenolobum, 21 Xanthisma_gracile, 22 Machaeranthera_tanacetifolia, 23 Oonopsis_wardii, 24 Oonopsis_engelmannii, 25 Haplopappus_glutinosus, 26 Corethrogyne_filaginifolia, 27 Lessingia_glandulifera, 28 Hazardia_squarrosa, 29 Pyrrocoma_crocea, 30 Pyrrocoma_lanceolata, 31 Xanthocephalum_gymnospermoides, 32 Grindelia_ciliata, 33 Rayjacksonia_phyllocephala, 34 Isocoma_veneta; TREE Fig._3 = [&R] ((1,2),3,(((4,((5,6),(9,10))),(7,8)),((11,(((12,13),14),(15,16),17),18,((19,20),21)),(22,(23,24)),((25,((26,27),28)),((29,30),((31,(33,34)),32)))))); END; BEGIN TREES; TITLE Tb10297; LINK TAXA = Taxa1; TRANSLATE 1 Psilactis_brevilingulata, 2 Symphyotrichum_drummondii, 3 Herrickia_kingii, 4 Xylorhiza_wrightii, 5 Arida_riparia, 6 Arida_blepharophylla, 7 Arida_turneri, 8 Arida_parviflora, 9 Dieteria_canescens, 10 Dieteria_bigelovii, 11 Xanthisma_texanum, 12 Xanthisma_rhizomatum, 13 Xanthisma_crutchfieldii, 14 Xanthisma_gymnocephalum, 15 Xanthisma_coloradoense, 16 Xanthisma_grindelioides, 17 Xanthisma_blephariphylla, 18 Xanthisma_viscidum, 19 Xanthisma_spinulosum, 20 Xanthisma_stenolobum, 21 Xanthisma_gracile, 22 Machaeranthera_tanacetifolia, 23 Oonopsis_wardii, 24 Oonopsis_engelmannii, 25 Haplopappus_glutinosus, 26 Corethrogyne_filaginifolia, 27 Lessingia_glandulifera, 28 Hazardia_squarrosa, 29 Pyrrocoma_crocea, 30 Pyrrocoma_lanceolata, 31 Xanthocephalum_gymnospermoides, 32 Grindelia_ciliata, 33 Rayjacksonia_phyllocephala, 34 Isocoma_veneta; TREE Fig._2 = [&R] ((1,2),3,(((4,(6,(9,10))),(5,(7,8))),((11,((12,13,14,(15,16,17)),18),((19,20),21),(22,(23,24))),(((25,(26,27)),28),((29,30),((31,(33,34)),32)))))); END; BEGIN TREES; TITLE Tb10300; LINK TAXA = Taxa2; TRANSLATE 1 Xanthisma_texanum_1, 2 Machaeranthera_tanacetifolia_1, 3 Xylorhiza_wrightii_1, 4 Xylorhiza_wrightii_2, 5 Xylorhiza_wrightii_3, 6 Xylorhiza_wrightii_4, 7 Arida_riparia_1, 8 Arida_riparia_2, 9 Arida_riparia_3, 10 Arida_riparia_4, 11 Arida_riparia_5, 12 Arida_riparia_6, 13 Arida_riparia_7, 14 Arida_riparia_8, 15 Arida_blepharophylla_1, 16 Arida_blepharophylla_2, 17 Arida_blepharophylla_3, 18 Arida_blepharophylla_4, 19 Arida_blepharophylla_5, 20 Arida_blepharophylla_6, 21 Arida_blepharophylla_7, 22 Arida_blepharophylla_8, 23 Arida_turneri_1, 24 Arida_turneri_2, 25 Arida_turneri_3, 26 Arida_parviflora_1, 27 Arida_parviflora_2, 28 Arida_parviflora_3, 29 Arida_parviflora_4, 30 Dieteria_canescens_1, 31 Dieteria_canescens_2, 32 Dieteria_canescens_3, 33 Dieteria_bigelovii_1, 34 Dieteria_bigelovii_2, 35 Dieteria_bigelovii_3; TREE Fig._4 = [&R] (1,2,((((3,5),4),6),((((((7,12),(8,14)),9,11,13),10),((23,24,25),(26,27,28,29))),((((15,17,20,22),(18,(19,21))),16),((30,31),(32,(33,34,35))))))); END;