#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:55 GMT TreeBASE (cc) 1994-2008 Study reference: Ban S., Sakane T., Toyama K., & Nakagiri A. 2009. Teleomorph-anamorph relationships and reclassification of Cordyceps cuboidea and its allied species. Mycoscience, 50: 261-272. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S9936] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=16; TAXLABELS Cordyceps_kanzasiana_AB027371 Cordyceps_prolifica_AB027370 Cordyceps_ramosopulvinata_AB02 Hirsutella_sp._NBRC103842 Ophiocordyceps_alboperitheciata_NBRC101740 Ophiocordyceps_alboperitheciata_NBRC103836 Ophiocordyceps_cuboidea_NBRC100941 Ophiocordyceps_cuboidea_NBRC103834 Ophiocordyceps_cuboidea_NBRC103835 Ophiocordyceps_paracuboidea_NBRC101739 Ophiocordyceps_paracuboidea_NBRC101742 Ophiocordyceps_prolifica_NBRC101750 Ophiocordyceps_prolifica_NBRC103838 Ophiocordyceps_prolifica_NBRC103839 Ophiocordyceps_ryogamiensis_NBRC101751 Ophiocordyceps_ryogamiensis_NBRC103837 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=60; TAXLABELS Claviceps_purpurea Cordyceps_cardinalis Cordyceps_gunnii Cordyceps_kanzasiana Cordyceps_militaris Cordyceps_prolifica Cordyceps_ramosopulvinata Cordyceps_scarabaeicola Elaphocordyceps_capitata Elaphocordyceps_inegoensis Elaphocordyceps_japonica_AB027 Elaphocordyceps_japonica_DQ518 Elaphocordyceps_jezoensis Elaphocordyceps_ophioglossoide Elaphocordyceps_paradoxa Elaphocordyceps_subsessilis Hirsutella_sp._NBRC103842 Hypocrea_lutea_AB0273 Hypocrea_lutea_AF5437 Hypomyces_chrysosperm Metacordyceps_taii Ophiocordyceps_acicularis Ophiocordyceps_alboperitheciata_NBRC101740 Ophiocordyceps_alboperitheciata_NBRC103836 Ophiocordyceps_aphodii Ophiocordyceps_brunneipunctata Ophiocordyceps_coccidiicola Ophiocordyceps_cochlidiicola Ophiocordyceps_cuboidea_NBRC100941 Ophiocordyceps_cuboidea_NBRC103834 Ophiocordyceps_cuboidea_NBRC103835 Ophiocordyceps_heteropoda Ophiocordyceps_irangiensis Ophiocordyceps_konnoana Ophiocordyceps_melolonthae Ophiocordyceps_nutans Ophiocordyceps_paracuboidea_NBRC100942 Ophiocordyceps_paracuboidea_NBRC101739 Ophiocordyceps_paracuboidea_NBRC101742 Ophiocordyceps_prolifica_NBRC100744 Ophiocordyceps_prolifica_NBRC101750 Ophiocordyceps_prolifica_NBRC103838 Ophiocordyceps_prolifica_NBRC103839 Ophiocordyceps_ravenelii Ophiocordyceps_ryogamiensis_NBRC101751 Ophiocordyceps_ryogamiensis_NBRC103837 Ophiocordyceps_sobolifera Ophiocordyceps_sphecocephala Ophiocordyceps_stylophora Ophiocordyceps_tricentri Ophiocordyceps_unilateralis Ophiocordyceps_variabilis Ophiocordyceps_yakusimensis Polycephalomyces_sp._NBRC103840 Polycephalomyces_sp._NBRC103841 Polycephalomyces_sp._NBRC103843 Polycephalomyces_sp._NBRC103844 Polycephalomyces_sp._NBRC103845 Torrubiella_confragosa Torrubiella_wallacei ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4714] TITLE Figure_1; LINK TAXA = Taxa2; DIMENSIONS NCHAR=503; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Claviceps_purpurea TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATACTTTTGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGATGCCAGCCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACGTGGTGTCGGATCATCAGCGTTCTCGCTGGTGCACTCCGCGGGCTCAGGCCAGCATCAGCTCGCCCGGGGGACAAAGGCAGCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGGGGCGGGCTGAGGTTCGCGCATCATGGATGCTGGCATAATGGTTATCACGAC Cordyceps_cardinalis TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGTAGAGGATGCTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGATGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGCGGTGAATCATCAGCGTTCTCGCTGGTGCACTTTGCGGGCACAGGCCAGCATCAGTTCGCGCGGGGGATAAAGGCTTTGGGAAGGCTCCGAGTGTTATAGCCCACTGCCCTGCGCCGGACTGAGGTACGCGCATCAAGGATGCTGGCGTAATGGTCATCACGAC Cordyceps_gunnii TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGATGCCAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGCGGATCATCAGCGTTCTCGCTGGTGCACTCCGCGGGCTCAGGCCAGCATCAGTTCGCGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCGCTGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Cordyceps_kanzasiana TAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTATCTGGCCCCGGGTCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCTGTGTGAAGCACCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCCCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCGGGGGATCACCGGCGTTTTTCGCGGGGCACTTCGGCTGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Cordyceps_militaris TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGTCCGAGTTGTATTTGTAGAGGATGCTTTTGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACACCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGCGGTGAATCACCAGCGTTCTCGCTGGTGCACTTCGCGGGCACAGGCCAGCATCAGTTTGCGCGGGGGAGAAAGGTTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGCTGGACTGAGGTACGCGCATCAAGGATGCTGGCGTAATGGTCATCACGAC Cordyceps_prolifica TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGACCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAAGCTCCGAGTGTTACAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Cordyceps_ramosopulvinata TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCAGGTCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCTGTGTGAAGCACCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCCCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCGGGGGATCACCGGCGTTTTCGCCGGGGCACTTCGGCTGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAAGCTCCGAGTGTTATAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Cordyceps_scarabaeicola TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCACGGGTCCGAGTTGTATTTATAGAGGATGCTTTTGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACACCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCCGGTGAATCATCAGCGTTCTCGCTGGTGCACTTTGCGGGCACAGGCCAGCATCAGTTTGCACGGGGGAAAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCGCCGGACTGAGGTACGCGCATCAAGGATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_capitata TAACGGCGAGTGAAGCGGCAGCAGCTCAGATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGCGGTGAATCATCAGCGTTCTCGCCGGTGCACTTCGCGGGCTCAGGCCAGCATCAGTCCGCGCGGGGGACAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGTCGCCCTGGGGCGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_inegoensis TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGTGAATCACCGGCGTTCTCGCCGGTGCACTTCGCGGGCCCAGGCCAGCATCAGTTCGCGCGGGGGACAAAAGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGCGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_japonica_AB027 TAACGGCGAGTGAAGCGGCAGCAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTCGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCGGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGCGGTGGATCACCAGCGTTCTCGCTGGTGCACTCCGCGGGCCCAGGCCAGCATCAGCTCGCGCGGGGGACAAAGGCCGCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCCGCGGCGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_japonica_DQ518 TAACGGCGAGTGAAGCGGCAGCAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTCGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCGGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGCGGTGGATCATCAGCGTTCTCGCTGGTGCACTCCGCGGGCCCAGGCCAGCATCAGCTCGCGCGGGGGACAAAGGCCGCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCCGCGGCGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_jezoensis TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGTGAATCATCAGCGTTCTCGCTGGTGCACTTTGCGGGCCCAGGCCAGCATCAGTTCGCGCGGGGGACAAAAGCTCCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGTGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCATGAC Elaphocordyceps_ophioglossoide TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGCCCCCAGGGCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGGGTGAATCATCAGCGTTCTCGCTGGTGCACTTCGCGGGCTCAGGCCAGCATCAGTTCGCGCGGGGGATAAAAGCTTCGGGAACGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGTGGACTGAGGTTCGTCCGTCCGCAATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_paradoxa TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCAGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCTAAGCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGTTCGTGACCAGACTTGGCGGCAAATCATCAGCGTTCTCGCTGGTGCACTTTGCAGGCTCAGGCCAGCATCAGTTCGTACGGGGGACAAAAGTTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGTAGCGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Elaphocordyceps_subsessilis TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGCGGTGAATCATCAGCGTTCTCGCTGGTGCACTTCGCGGGCCCAGGCCAGCATCAGTTCGCGCGGGGGATAAAAGCTTCGGGAAAGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGTGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCACCATGAC Hirsutella_sp._NBRC103842 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTACAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Hypocrea_lutea_AB0273 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGTCCGAGTTGTATTTGTAGAGGATGCTTTTGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGCTGGCCACCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGCGGATCATCGGGGTTCTCCCCGGTGCACTTCGCGCGTTCAGGCCAGCATCAGTTCGCGCGGGGGATAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGTGGACTGAGGACCGCGCATCAAGGATGCTGGCGTAATGGTCACCACGAC Hypocrea_lutea_AF5437 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGTCCGAGTTGTATTTGTAGAGGATGCTTTTGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGCTGGCCACCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGCGGCGGATCATCGGGGTTCTCTCCGGTGCACTTCGCGCGTTCAGGCCAGCATCAGTTCGCGCGGGGGATAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGTGGACTGAGGACCGCGCATCAAGGATGCTGGCGTAATGGTCACCACGAC Hypomyces_chrysosperm TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGTGAGGCGCCGCCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGCTGGCCGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGTGGCGAATCATCGGCGTTCTCGCCGGTGCACTTCGCAGGCTCAGGCCAGCATCAGTTCGCGCGGGGGATAAAGGTTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGGTGGACTGAGGTCCGCGCATCAAGGATGCTGGCGTAATGGTCATCACGAC Metacordyceps_taii TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGTCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGATACCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGCGGTGAATCATCAGCGGCCCCGCTGGTGCACTTTGGGGGTTCAGGCCAGCATCAGTTCGTCCGGGGGATAAAGGCTTTGGGAAGGCTCCGAGTGTTATAGCCCATTGCCTTGTGGCGGGCTGAGGTTCGCGCTTCAAGGATGCTGGCATAATGGTCATCATGAC Ophiocordyceps_acicularis TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCGCCGCGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGATGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGGTGGCGGATCATCGGCGTTCTCGCCGGTGCACTCCGCTCGCCCGGGCCAGCATCAGTTCGCGCGGGGGATAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGGCGCCCCGTGGCGGACTGAGGTTCGCGCGTCAAGGATGCTGGCGTAATGGTCACCATGAC Ophiocordyceps_alboperitheciata_NBRC101740 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTTGGGCGGGGGATAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_alboperitheciata_NBRC103836 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_aphodii TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTACCTGCAGAGGATGCTTCGGCGCCGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGCGGCCCGCCCGCGTGAAGCGCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACTCGGCGGCGGATCGGTGGCGCCCGCGCCGGCGCACTCCGCGCGCCCGGGCCAGCATCGGCTCGGGCGGCGAACAAAGGCGGCGGGAAGGCCCCGGGTGTTATAGCCCGCCGCGTCGGCGCGGGCCGAGGACCGCGCCCCAAGGATGCTGGCGTAATGGTCGCCATGAC Ophiocordyceps_brunneipunctata TAACGGCGAGTGAAGCGGCAGCAGCTCAGATTTATCTGGCCCCGGGTCCGAGTTGTATCTGCAGAGGATGCTTCCGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGACGCCCGCCGGTGTGAAGCTCCTTCGGCGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGCCTTCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTCGCGGCCAGACTCGGCGGCGGATCATCGGCGTCCTCGCCGGTGCGCTCCGGCCGCCCGGGCCAGCATCGGCTCGGGCGGGGGACAAAGGCGGCGGGAAGGCCCCGGGTGTTATAGCCCGCCGCCCCGCCGCGGGCCGAGGACCGCGCCCCAAGGATGCTGGCGTAATGGCCGCCACGAC Ophiocordyceps_coccidiicola TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCTCCGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGGCCAGACTCGGCGGCGGATCATCGGCGTTCTCGCCGGTGCACTCCGCGCGCCCGGGCCAGCATCGGCTCGCGCGGGGGACAAAGGCGCCGGGAAGGCTCCGAGTGTTATAGCCCGGCGCCCCGCGGCGGACCGAGGTTCGCGCGTCAAGGATGCTGGCGTAATGGCCACCATGAC Ophiocordyceps_cochlidiicola TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCCGGCGCCGCGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGGTGGCGGATCATCGGCGTTCTCGCCGGTGCACTCCGCCCGCCCGGGCCAGCATCAGCTCGCGCGGGGGATAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGGCGCCCCGTGGCGGACTGAGGTTCGCGCGTCAAGGATGCTGGCGTAATGGTCACCATGAC Ophiocordyceps_cuboidea_NBRC100941 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_cuboidea_NBRC103834 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_cuboidea_NBRC103835 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_heteropoda TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCCGCGCAGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTAGTCGGACGCCAGCCACTGTGAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAAGAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACTTGGCGGGGGATCATCGGCGTTCTCGCCGGTGCACTCCGCGGGCCCAGGCCAGCATCAGTTCGCGCGGGGGACAAAGGCGCCGGGAAGGCTCCGAGTGTTATAGCCCGGCGCCCCGCCGCGGACTGAGGCACGCGCTCCAAGGATGCTGGCGTAATGGTCCCCACGAC Ophiocordyceps_irangiensis TAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTATCTGGCCTCGGGTCCGAGTTGTATTTGCAGAGGATGCTTTTGCATAGCACTATCCGAGTTCCCTGGAATGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTAGCTGCGAGCCTCTATAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAGGGGAGGTATATGTCTTCTAAGGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGCTAAAAGGGAAGCGCTTACAACTAGACGTGGCGTGCAATCAACAGTATTCTTACTAGGGCACTTGGGCCATCTAGGCTAGCATTGGTTTGTATAGGGGATAAAGACTCTAGGAAAGCCCCGGGTGTTATAGCCTAGTGCCCTATGGCAGACCAAGGTCCGCGCTTCAAGGATGCTGGCATAATGGTTGTTATGAC Ophiocordyceps_konnoana TAACGGCGAGTGAAGCGGCAACAGCTCACATTTATCCGGCCCCGGGCCCGAGTTGTACCTGCAGAGGACGCTTCGGCGCGGCGCCCGCCGAGTTCCCTGGGACGGGACGCCGCAGAGGGTGAGAGCCCCGTCGCCGGCCGCCCGCCCCCGTGAAGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAGGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACGCGGCGGTGGCTCACCGGCGCCGTCGCCGGTGCGCTCCGCGCGCCCGGGCCAGCATCGGCTCGCGCGGGGGACAAAGGCGGCGGGAAGGCTCCGAGTGTTACAGCCCGCCGCCCCGCGGCGGACCGAGGCGCGCGCGTCAAGGATGCTGGCGTAATGGTCGCCACGAC Ophiocordyceps_melolonthae TAACGGCGAGTGAAGCGGCAGCAGCTCAAATTTATCCGGCCGCGGGCCCGAGTTGTATTTGCAGAGGACGCTTCAGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTAGTCGGACGCCAGCCAGCGTGAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACTTGGCGGTGGATCACCGGCGTTCTCGCCGGCGCACTCCGCGGGCCCAGGCCAGCATCAGCTCGCGCGGGGGACAAAGGCGGCGGGAAGGCTCCGAGTGTTATAGCCCGCCGCCCCGCGGCGGACTGAGGCCCGCGCTCCAAGGATGCTGGCGTAATGGTCGCCACGAC Ophiocordyceps_nutans TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCTTTAAGTCCGAGTTGTATTTGCAGAGGATGCTTTTGCGTGGCACTAACTAAGTTCCCTGGAATGGGACGCCATAGAGGGTAAGAGCCCCGTCGTTAGGCGCTAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAGGGGAGGTATATGTCTTCTAAAGCTAAATATCAGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCACTTGCAACTAGACGTAGGTGCCAATCACCGGCATTTGTGTCAGGGCACTTGGCGATGCTAGGCCAGCATCGGTTTGTGTGGGGGATAAAGACATCTGGAAAGCCCTGGGTGTTATAGCCAGGTGCCCTGCGGCAGACCGAGGACCTTGCGCCAAAGATGCTGGCGTAATAGTTGCTATGAC Ophiocordyceps_paracuboidea_NBRC100942 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCTCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_paracuboidea_NBRC101739 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCTCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_paracuboidea_NBRC101742 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCTCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTATAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_prolifica_NBRC100744 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGACCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGGGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTACAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_prolifica_NBRC101750 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGACCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGGGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTACAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_prolifica_NBRC103838 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGACCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAAGCTCCGAGTGTTACAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_prolifica_NBRC103839 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGACCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCAGTTCGGGCGGGGGACAAAGGCTTCGGGAAAGCTCCGAGTGTTACAGCCCGCTGCCCTGCCGCGGACTGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_ravenelii TAACGGCAAGTGAAGCGGCAACAGCTCAGATTTATCCGGCCCCGGGCCCGAGTTGTATCTGCAGAGGATGCCTCCGCGCGCGGCCTTCCGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTAGTCGGCCGCCAGCCCCTGTGAGGCCCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCCAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACGCGGCGGCGGAACACCGGCGCTCTCGCCGGCGCGCTCCGGGCGCCCGGGCCAGCATCGGTTCGCGCGGGGGACAAAGGCGGCGGGAAGGCTTCGAATGTTATAGCCCGCCGCCCCGGGGCGGACCGAGGCACGCGCGTCAAGGATGCTGGCGTAATGGTCGCCACGAC Ophiocordyceps_ryogamiensis_NBRC101751 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTACAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_ryogamiensis_NBRC103837 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCTGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGCCGCGCATCACCGGCGTTCTCGCCGGGGCACTTCGAGGGCCCAGGCCAGCATCGGTTCGGGCGGGGGACAAAGGCTTCGGGAAGGCTCCGAGTGTTACAGCCCGCTGCCCTGCTGCGGACCGAGGTTCGCGCTTCAAGGATGCTGGCGTAATGGTCATCACGAC Ophiocordyceps_sobolifera TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGCCGCCAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGGACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACTCGGCGGCGGATCATCGGCGTCCTCGCCGGTGCACTCCGGGCGCCCGGGCCAGCATCGGCTCGCGCGGGGGATAAAGGCGGCGGGAAGGCCCCGGGTGTTATAGCCCGCCGCCCCGCCGCGGGCCGAGGACCGCGCCCCAAGGATGCTGGCGTAATGGTCGCTACGAC Ophiocordyceps_sphecocephala TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCTTAGGTCCGAGTTGTATTTGCAGAGGATGCTTTTGTGCGGCACCATCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGATGCCAGCCTCTATAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAGGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGCTGAAAGGGAAGCGCTTATAACCAGACGTGGCTATCAATCACCAGTATTTTTACTGGCTTATTTGGGTTTCCCAGGCTAGCATCGGTTTGTATAGGGGATAAAGACACTTGGAAAGCCCCGGGTGTTATAGCCTTGTGCCCTATGGTGGACCGAGGAACGCGCATCAAGGATGCTGGCGTAATGGTTATTATGAC Ophiocordyceps_stylophora TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGCGGCGAATCATCGGCGTTCTCGCCGGTGCACTTCGCGCGCCCGGGCCAGCATCAGTTCGCGCGGGGGACAAAGGCGCCGGGAAGGCTCCGAGTGTTATAGCCCGGCGCCCCGCGGCGGACTGAGGTTCGCGCATCAAGGATGCTGGCGTAATGGTCACCATGAC Ophiocordyceps_tricentri TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCTTCAAGTCCGAGTTGTATTTGCAGAGGATGCTTTTGTACGGCACCGAACAAGTTCCCTGGAACGGGACGCCACAGAGGGTAAGAGCCCCGTCGTCGGAAGCCAGCCTCTATAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGCTAAAAGGGAAGCGCTTACAACTAGACGTGGTGTTCAATCACCAGTGTCTTCACTGGGGCACTTGGGTTTTCCAGGCCAGCATCGGTTTGTACGGGGGATAAAGACGCTAGGAAAGCCCCGGGTGTTATAGCCTAGTGCCCTGTAGCAGACCGAGGTCTGCGCATCAAGGATGCTGGCGTAATAGTTGTTATGAC Ophiocordyceps_unilateralis TAACGGCGAGTGAAGCGGCAACAGCTCAGATTTATCCGGCGCCACGCCCGAGTTGTATCTGCAGAGGACGCTCCTGCGCGGCGCCGTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTAGTCGGACGCCAGCCTGTGTGGAGCCCCTTCGGCGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATACGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACTCGGCGGGGGATCATCGGCGCTCGCGCCGGTGCACTCCGGGGCCCCGGGCCAGCATCGGCCCGGGCGGGGGACAAAGGCGCCGGGAAGGCTCCGAGTGTTATAGCCCGGCGCCCCGCGGCGGGCCGAGGTTCGCGCGTCAAGGATGCTGGCGTAATGGCCACCACGAC Ophiocordyceps_variabilis TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCCGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTCTGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCGTCGGCCGCCAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACTTGGCGTCGGGTCACCGGCGTCGCCGCCGGGGCACTCCGCGGGCCCAGGCCAGCATCAGCTCGCGCGGGGGACAAAGGCGCCGGGAAGGCCCCGGGTGTTATAGCCCGGCGCCCCGCGGCGGGCTGAGGCCCGCGCCCCAAGGATGCTGGCGTAATGGTCGCCACGAC Ophiocordyceps_yakusimensis TAACGGCGAGTGAAGCGGCAGCAGCTCAAATTTATCTGGCTCCGCGCCCGAGTTGTATTTGCAGAGGATGCCTCTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTAGTCGGCCGCCAGCCTCTGTGAGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGCGACCAGACTCGGCGGCGGATCATCGGCGTCCTCGCCGGTGCACTCCGGGCGCCCGGGCCAGCATCGGCTCGCGCGGGGGATAAAGGCGGCGGGAAGGCCCCGGGTGTTATAGCCCGCCGCCCCGCGCCGGGCCGAGGACCGCGCCCCAAGGATGCTGGCGTAATGGTCGCTACGAC Polycephalomyces_sp._NBRC103840 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGACGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGACGGTGAATCATCAGCGTTCTCGCTGGTGCACTTCGCGGGCCCAGGCCAGCATCGGTTCGCGCGGGGGAGAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGTCGCCCTGGGGCGGACCGAGGTTCGCGCATCAAGGATGCTGGCGTAATGGTCGTCACGAC Polycephalomyces_sp._NBRC103841 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGACGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGACGGTGAATCATCAGCGTTCTCGCTGGTGCACTTCGCGGGCCCAGGCCAGCATCGGTTCGCGCGGGGGAGAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGTCGCCCTGGGGCGGACCGAGGTTCGCGCATCAAGGATGCTGGCGTAATGGTCGTCACGAC Polycephalomyces_sp._NBRC103843 TAACGGCGAGTGAAGCGGCAGCAGCTCAAATTTATCTGGCCGCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGCGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGGGCGAATCATCGGCGTTCTCGCCGGTGCACTTCGCGGGCCCAGGCCAGCATCAGTCCGCGCGGGGGACAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGTCGCCCTGCGGCGGACTGAGGTTCGCGCTCCAAGGATGCTGGCGTAATGGTCATCACGAC Polycephalomyces_sp._NBRC103844 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGACGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGACGGTGAATCATCAGCGTTCTCGCTGGTGCACTTCGCGGGCCCAGGCCAGCATCGGTTCGCGCGGGGGAGAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGTCGCCCTGGGGCGGACCGAGGTTCGCGCATCAAGGATGCTGGCGTAATGGTCGTCACGAC Polycephalomyces_sp._NBRC103845 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGCAGAGGATGCTTTTGCGACGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTTGGACGCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAAGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGACGGTGAATCATCAGCGTTCTCGCTGGTGCACTTCGCGGGCCCAGGCCAGCATCGGTTCGCGCGGGGGAGAAAGGCGTCGGGAAGGCTCCGAGTGTTATAGCCCGTCGCCCTGGGGCGGACCGAGGTTCGCGCATCAAGGATGCTGGCGTAATGGTCGTCACGAC Torrubiella_confragosa TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGTCCGAGTTGTATTTGTAGAGGATGCTTTTGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCGTCGGACACCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGCGGTGAATCATCAGCGTTCTCGCTGGTGCACTTTGCGGGCACAGGCCAGCATCAGTTTGCGCGGGGGATAAAGGCTTTGGGAAGGCTCCGAGTGTTATAGCCCACTGCCCTGCGCCGGACTGAGGCACGCGCATCAAGGATGCTGGCGTAATGGTCATCACGAC Torrubiella_wallacei TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTATCTGGCCCCGGGCCCGAGTTGTATTTGTAGAGGATGCTTTTGCGAGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCGTCGGATGCCAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAAGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGCGGTGAATCATCAGCGTTCTCGCTGGTGCACTTTGCGGGCACAGGCCAGCATCAGTTTGCGCGGGGGATAAAGGTTTCGGGAAGGCTCCGAGTGTTATAGCCCGTTGCCCTGCGCCGGACTGAGGTACGCGCATCAAGGATGCTGGCGTAATGGTCATCACGAC ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Figure_1) = N: 1-503; CODONPOSSET CodonPositions (CHARACTERS = Figure_1) = N: 1-503; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4391] TITLE Figure_2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=739; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cordyceps_kanzasiana_AB027371 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCAGTGTGAACCTCTACCTCAT-CGTTGCCTCGGCGGGA--TCGCCCCGGC--GCGCC----CCTTCTACAGGGGCGT---CCGGATCACTACGGCGCCCGCCGCAGGACCCCCAA---ACTCTTTTCGCCTCTCTCCAGGCGTCGGTTTTCTTCTGAGTGAGACCTTTTTCCTCGCGACAGCGGGGTGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGCCCCCTC-----------TGTAGGGGACTGGTGTTGGGGGGCGGCATCGCTGGGAGGGAGGGGGTCGTCTC----CCCCTTCCTCCTCCGCCGCCGCCCCCGAAATACAGTGGCGGCCTCGCCGCAGCGACCTCCGCGTAGTAGCAC--A-AACCTCGCGGCCTGGGAAGCTGGGCGCGGCCACAGCCGTGAAA---------------------------CACC--CCCTTACGCGAAGAA--------------GACTCTTCGCTCCT-AAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Cordyceps_prolifica_AB027370 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAAACTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGC-GGCGCCG---CCCAGCGC-GG--CGC--CCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGAATT-CCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGGCCCC------------GAGAGGGGACCTGGCGTTGGGGGACGGCAC--CCGCG---GGCCAACCAG-------------------CCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAACAAACACCTCGCGGCAA-GGGAGCGCGGCGCGGCCAC-GCCGTGAAAACG-----------------------ACGCC-GCAACTC-GCGGA-------------CT-CAACC---CCCCC---TAGAGTTGACCTCGGATCAGGTAGGAATACCCGCCGAACTTAA Cordyceps_ramosopulvinata_AB02 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCAGTGTGAACCTCTACCTCAT-CGTTGCCTCGGCGGGA--TCGCCCCGGC--GCGCC----CCC-CTCCAGGGGCGT---CCGGACCAC-ACGGCGCCCGCCGCAGGACCCCCTA---AACTCTCTCGCCCCTCC---GGCGTCG-TTTTCTTCTGAGT-AGACCTTTTTCCTCGCGAGAGCGGGGTGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGCCCCCGT-----------CAGGGGGACCTGGCGTTGGGGGACGGCACCGCTGGGAGGAGGGAAGGAGTCTCGTCTCCCCCTCCCCCCCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCTCGCCGCAGCGACCTCCGCGTAGTAGCAC--AGAACCTCGCGGCCTGGGA-GCTGGGCGCGGCCAC-GCCGTAAAA---------------------------CACC--CCCT-ACGCGAAAA-----------------CCCTTCGCACC--AAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Hirsutella_sp._NBRC103842 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCGCTCAGCGC-GGCGCGCCCCCCGGACACCAA-GGCGCCCGCCGCAGGACCGCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTC----------TCCAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAAAGGG--------------CCCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGT-GCGCAGCACACGCC--CCCCGCAGCACC-CCCCCAATCAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_alboperitheciata_NBRC101740 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCCATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCCCTCAGCGC-GGTGCGCCTCCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTG----------GAGAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAA-GGG--------------CCCTGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGTTGCACAGCACACGCC--CCCCGCAGCACAGCACCCCATTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_alboperitheciata_NBRC103836 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCCATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCCCTCAGCGC-GGTGCGCCTCCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTG----------GAGAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAA-GGG--------------CCCTGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGTTGCACAGCACACGCC--CCCCGCAGCACAGCACCCCATTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_cuboidea_NBRC100941 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCCATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCCCTCAGCGC-GGTGCGCCTCCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTC----------TCCAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAA-GGG--------------CCCTGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGTTGCACAGCACACGCC--CCCCGCAGCACAGCACCCCATTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_cuboidea_NBRC103834 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCCATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCCCTCAGCGC-GGTGCGCCTCCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTG----------GAGAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAA-GGG--------------CCCTGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGTTGCACAGCACACGCC--CCCCGCAGCACAGCACCCCATTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_cuboidea_NBRC103835 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCCCATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCCCTCAGCGC-GGTGCGCCTCCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTG----------GAGAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAA-GGG--------------CCCTGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGTTGCACAGCACACGCC--CCCCGCAGCACAGCACCCCATTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_paracuboidea_NBRC101739 ---TCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAAACTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGC-GGCGCCCGC-CCCAGCGC-GGTACGC--CCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCCCCTTCCG----AGGGGGGGACCTGGCGTTGGGGGACGGCAA--CCGCGGGGGGCCACCAAAGGCC--------------CCCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCA--AAACACCTCGCGGGAAAGGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGTTTGTGTGTGTGTGTGTGCCTGGGCGCCCGCGACTCCGCGGAAGACCACGCAACGCACCGACACC-CCCCC---TAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_paracuboidea_NBRC101742 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAAACTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGC-GGCGCCCGC-CCCAGCGC-GGTACGC--CCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCCCCTTCCG----AGGGGGGGACCTGGCGTTGGGGGACGGCAA--CCGCGGGGGGCCACCAAAGGCC--------------CCCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCA--AAACACCTCGCGGGAAAGGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGTTTGTGAGTGTGTGTG--CCTGGGCGCCCGCGACTCCGCGGAAGACCACGCAACGCACCAACAACCCCCCC---TAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_prolifica_NBRC101750 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAAACTCCCAAACCCC-ATGTGAACCTTAACCTCAAACGTTGCCTCGGCGGGGACTCGCCCCGGC-GGCGCCG---CCCAGCGC-GG--CGC--CCCGGACAACAAAGGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTCGACAGGTGGAATT-CCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCCCCCTCGGAAGGGGGGGGGAACCTGGCGTTGGGGGACGGCAC--CCGCGC--GGCCAGCCGG-------------------CCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCA--AAACACCTCGCGGCAA-GGGAGCGCGGCGCGGCCAC-GCCGTGAAATCG-----------------------ACGCC-GCAACTC-GCGGA-------------TCACGACAA--CCCCC---TAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_prolifica_NBRC103838 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAAACTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGC-GGCGCCG---CCCAGCGC-GG--CGC--CCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGAATT-CCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGGCCCC------------GAGAGGGGACCTGGCGTTGGGGGACGGCAC--CCGCG---GGCCAACCAG-------------------CCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAACAAACACCTCGCGGCAA-GGGAGCGCGGCGCGGCCAC-GCCGTGAAAACG-----------------------ACGCC-GCAACTC-GCGGA-------------CT-CAACC---CCCCC---TAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_prolifica_NBRC103839 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAAACTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGC-GGCGCCG---CCCAGCGC-GG--CGC--CCCGGACACCAA-GGCGCCCGCCGCAGGACCCCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGAATT-CCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGGCCCC------------GAGAGGGGACCTGGCGTTGGGGGACGGCAC--CCGCG---GGCCAACCAG-------------------CCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAACAAACACCTCGCGGCAA-GGGAGCGCGGCGCGGCCAC-GCCGTGAAAACG-----------------------ACGCC-GCAACTC-GCGGA-------------CT-CAACC---CCCCC---TAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_ryogamiensis_NBRC101751 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCGCTCAGCGC-GGCGCGCCCCCCGGACACCAA-GGCGCCCGCCGCAGGACCGCCGAAGAAACTCTTCTACTGCATTTGACAGGTGGCATTTCCTCTGAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTC----------TCCAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAAAGGG--------------CCCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCGTCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGT-GCGCAGCACACGCC--CCCCGCAGCACC-CCCCCAATCAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Ophiocordyceps_ryogamiensis_NBRC103837 TCTCCGTTGGTGAACCAGCGGAGGGATCATTACC-GAGTTTACAA-CTCCCAAACCCC-ATGTGAACCTTAACCTCAA-CGTTGCCTCGGCGGGGACTCGCCCCGGCCGGCGCCCGCGCTCAGCGC-GGCGCGCCCCCCGGACACCAA-GGCGCCCGCCGCAGGACCGCCGAAGAAACTCTTCTACTGCATTTAACAGGTGGCATTTCCTCTAAGT-GGACTCTTCTCCCCGCGACAGCGGTGGGCGAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATACCTGTCCGAGCGTCATTTCGACCCTCAGGTCCCCTC----------TCCAGGGGACCTGGCGTTGGGGGACGGCAAG-CCGCGGGCGCCCGACCAAAGGG--------------CCCCGCCGCCGCCCCCGAAATGCAGTGGCGGCCACGTCGCAGCGACCTCCGCGTAGTAGCAA-AAACACCTCGCGGCAA-GGGAGCGCATCGCGGCCAC-GCCGTGAAACCGT----------------------GTGCGGGCCGTGT-GCGCAGCACACGCC--CCCCGCAGCACC-CCCCCAATCAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Figure_2) = N: 1-739; CODONPOSSET CodonPositions (CHARACTERS = Figure_2) = N: 1-739; END; BEGIN TREES; TITLE Tb10302; LINK TAXA = Taxa1; TRANSLATE 1 Ophiocordyceps_cuboidea_NBRC100941, 2 Ophiocordyceps_alboperitheciata_NBRC101740, 3 Ophiocordyceps_prolifica_NBRC101750, 4 Ophiocordyceps_ryogamiensis_NBRC101751, 5 Ophiocordyceps_alboperitheciata_NBRC103836, 6 Hirsutella_sp._NBRC103842, 7 Ophiocordyceps_prolifica_NBRC103838, 8 Ophiocordyceps_prolifica_NBRC103839, 9 Ophiocordyceps_ryogamiensis_NBRC103837, 10 Ophiocordyceps_cuboidea_NBRC103835, 11 Ophiocordyceps_paracuboidea_NBRC101739, 12 Ophiocordyceps_paracuboidea_NBRC101742, 13 Ophiocordyceps_cuboidea_NBRC103834, 14 Cordyceps_prolifica_AB027370, 15 Cordyceps_ramosopulvinata_AB02, 16 Cordyceps_kanzasiana_AB027371; TREE Fig._2 = [&R] ((15,16),(((3,((7,14),8)),(11,12)),(((4,9),6),(1,(5,(10,(2,13))))))); END; BEGIN TREES; TITLE Tb10301; LINK TAXA = Taxa2; TRANSLATE 1 Claviceps_purpurea, 2 Cordyceps_cardinalis, 3 Cordyceps_gunnii, 4 Cordyceps_kanzasiana, 5 Cordyceps_militaris, 6 Cordyceps_prolifica, 7 Cordyceps_ramosopulvinata, 8 Cordyceps_scarabaeicola, 9 Elaphocordyceps_capitata, 10 Elaphocordyceps_inegoensis, 11 Elaphocordyceps_japonica_AB027, 12 Elaphocordyceps_japonica_DQ518, 13 Elaphocordyceps_jezoensis, 14 Elaphocordyceps_ophioglossoide, 15 Elaphocordyceps_paradoxa, 16 Elaphocordyceps_subsessilis, 17 Hirsutella_sp._NBRC103842, 18 Hypocrea_lutea_AB0273, 19 Hypocrea_lutea_AF5437, 20 Hypomyces_chrysosperm, 21 Metacordyceps_taii, 22 Ophiocordyceps_acicularis, 23 Ophiocordyceps_alboperitheciata_NBRC101740, 24 Ophiocordyceps_alboperitheciata_NBRC103836, 25 Ophiocordyceps_aphodii, 26 Ophiocordyceps_brunneipunctata, 27 Ophiocordyceps_coccidiicola, 28 Ophiocordyceps_cochlidiicola, 29 Ophiocordyceps_cuboidea_NBRC100941, 30 Ophiocordyceps_cuboidea_NBRC103834, 31 Ophiocordyceps_cuboidea_NBRC103835, 32 Ophiocordyceps_heteropoda, 33 Ophiocordyceps_irangiensis, 34 Ophiocordyceps_konnoana, 35 Ophiocordyceps_melolonthae, 36 Ophiocordyceps_nutans, 37 Ophiocordyceps_paracuboidea_NBRC100942, 38 Ophiocordyceps_paracuboidea_NBRC101739, 39 Ophiocordyceps_paracuboidea_NBRC101742, 40 Ophiocordyceps_prolifica_NBRC100744, 41 Ophiocordyceps_prolifica_NBRC101750, 42 Ophiocordyceps_prolifica_NBRC103838, 43 Ophiocordyceps_prolifica_NBRC103839, 44 Ophiocordyceps_ravenelii, 45 Ophiocordyceps_ryogamiensis_NBRC101751, 46 Ophiocordyceps_ryogamiensis_NBRC103837, 47 Ophiocordyceps_sobolifera, 48 Ophiocordyceps_sphecocephala, 49 Ophiocordyceps_stylophora, 50 Ophiocordyceps_tricentri, 51 Ophiocordyceps_unilateralis, 52 Ophiocordyceps_variabilis, 53 Ophiocordyceps_yakusimensis, 54 Polycephalomyces_sp._NBRC103840, 55 Polycephalomyces_sp._NBRC103841, 56 Polycephalomyces_sp._NBRC103843, 57 Polycephalomyces_sp._NBRC103844, 58 Polycephalomyces_sp._NBRC103845, 59 Torrubiella_confragosa, 60 Torrubiella_wallacei; TREE Fig._1 = [&R] (((((((((50,33),48),36),((4,7),((((40,41),(6,(42,43))),((37,38),39)),(23,(((45,46),17),((29,24),(30,31))))))),((((((47,53),(25,26)),((34,44),51)),52),(32,35)),(((28,22),27),49))),(((((13,(14,16)),10),((11,12),3)),15),(9,56))),(((54,55),57),58)),(((((8,59),5),60),2),(21,1))),((18,19),20)); END;