#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 22:48 GMT TreeBASE (cc) 1994-2008 Study reference: Devos N., Barker N., Nordenstam B., & Mucina L. 2010. A multi-locus phylogeny of Euryops (Asteraceae, Senecioneae) augments support for the Cape to Cairo hypothesis of floral migrations in Africa. Taxon, 59(1): 57-67. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S9979] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=71; TAXLABELS Euryopoides_DOUBELL29 Euryops_abrotanifolius_ND130705_2C Euryops_abrotanifolius_ND160705_5 Euryops_abrotanifolius_ND280805_1 Euryops_abrotanifolius_ND310805_1 Euryops_abrotanifolius_ND310805_6 Euryops_abrotanifolius_RM1056 Euryops_acraeus_CH05 Euryops_algoensis_NB1908 Euryops_annae_CDM4 Euryops_annuus_ND010905_4 Euryops_anthemoides_ND120605_3 Euryops_anthemoides_TD452 Euryops_arabicus_8134UPS Euryops_arabicus_8850UPS Euryops_arabicus_9438UPS Euryops_brachypodus_ND01 Euryops_brachypodus_RM1108 Euryops_brevilobus_ND010905_6 Euryops_brownei_B248 Euryops_candollei_CC352 Euryops_dacrydioides_UPS4377 Euryops_dacrydioides_UPSdacry Euryops_decumbens_CH09 Euryops_dregeanus_ND090905_6 Euryops_dregeanus_ND090905_7 Euryops_empetrifolius_PRETO529 Euryops_ericifolius_PALMER3934 Euryops_ericoides_ND160705_3 Euryops_euryopoides_YOUTHED751 Euryops_evansii_CH04 Euryops_evansii_CH11 Euryops_evansii_ND190106 Euryops_galpinii_ND081005_4 Euryops_hebecarpus_ND160705_1 Euryops_hypnoides_TD4700 Euryops_lateriflorus_NB1487 Euryops_lateriflorus_ND040905_4 Euryops_lateriflorus_ND060905_11 Euryops_lateriflorus_ND130206 Euryops_lignifolius_ND140705_2 Euryops_montanus_1XT5314 Euryops_multifidus_ND040905_3 Euryops_munitus_BROWN130898 Euryops_othonnoides_ND010905_1 Euryops_othonnoides_ND120905_6 Euryops_pectinatus_ND290805_2 Euryops_petraeus_CDM2 Euryops_pinifolius_UPSpinni Euryops_prostratus_Eth Euryops_spathaceus_ND120605_2 Euryops_spathaceus_ND120605_4 Euryops_speciosissimus_ND310805_4 Euryops_speciosissimus_RM1058 Euryops_subcarnosus_ND080905_1 Euryops_tenuissimus_ND020905_4 Euryops_tenuissimus_ND130705_1 Euryops_trilobus_CDM3 Euryops_tysonii_CH08 Euryops_ursinoides_TD4649 Euryops_virgineus_ND260805 Euryops_virgineus_RM1023 Gymnodiscus_capillaris_LM110805_3 Gymnodiscus_capillaris_ND300805_1 Hertia_pallens Othonna_carnosa_ND120605_1 Othonna_eriocarpa_NB1938 Othonna_euphorbioides_ND060905_3 Othonna_sedifolia_LM060605_13 Othonna_sedifolia_ND050905_1 Othonna_spnov_LM210903_6 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4465] TITLE ITS_Plus_cpDNA_combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2611; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Euryopoides_DOUBELL29 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTCAATGTGCG-TCGTTGGTCGGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGTACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACC---CTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_abrotanifolius_ND130705_2C TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGATACCCCGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTTTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TTTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATCAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGGGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAT-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_abrotanifolius_ND160705_5 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGTATACCTTGTTAATGTGCG-TCTTTGGTCAACCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGATGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCGTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATAAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_abrotanifolius_ND280805_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGTATACCTTGTTAATGTGCG-TCTTTGGTCAACCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGATGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATAAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTGAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_abrotanifolius_ND310805_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGATACCCCGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTTTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TTTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATCAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGGGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATACAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAT-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_abrotanifolius_ND310805_6 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGTATGCCTTGTTAATGTGCG-TCTTTGGTCAACCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGTTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATATGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGA---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATCGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATCAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAATTCTTTAATATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCC----------------------TTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAT-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_abrotanifolius_RM1056 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGTATGCCTTGTTAATGTGCG-TCTTTGGTCAACCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGTTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATATGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGA---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATCAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAATTCTTTAATATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAT-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_acraeus_CH05 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGTTACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATCAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGCAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTT-----ATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG-------GATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCCACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATAT-----------ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTTTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTAATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATT-GAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_algoensis_NB1908 TCGAAACCTGCGTAGCAGAACGACCTGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCCGACAA---TTGTTT--GATTCTTTGGATAACCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATCAAC-ACAATAACAAACCCCCGGCACGGTATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTAACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACTCATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCTCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGAAA-GATCTCGTCAAAGACCCTAATGTGTT-GTCT-TGTAACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAC--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAATTTTAATGTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCAT---------------ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAAGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTA--ATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTTT------GTTCTATAATA Euryops_annae_CDM4 TCGAAACCTGCATAGCAGAACGACCCGCGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TTTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGT{AG}GCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGCAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------AGAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAG--------------------------------G------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTATTGTTATGTTC-----TA Euryops_annuus_ND010905_4 TCGAAACCTGCATGGCAGAACGACCCGTGAACATGTAATAA--CAGTCGGGTGTCCAAGGCATCTAACTTCTTTTGTTT--GATTCTTTGGATGCCTTGTTGATGTGCT-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAGC-ATAATAAC-AACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAGGTTCGTCCCATGTTTCCTCGTTCGCGGGGTTTGCATGAGATGTGGCTTCTTT-ATAATTACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC---CTACATCTCTT-GATGGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTCCGGTTGGCTAAAATAC-GAGTCCTCTTCGAAGGACGCACGATTAGTGGTGGTTTTCAAGACCTTCTTATCGA--CTCGTGCGTTATAAGGAGCAAGGAA-GATCTCTAGAAAAACCCCAATGTGTT-GTCCATGTGATGATACTTTGACCATTCTTTTTATTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCC---GGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAATTGTTGGAAGGGTTAAAACTTTGTCGATACACAGTGTATCGCGCACGAATCAACCGTAGGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATTCGAATAAAGAA-----TCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAAGAAAAATATTTAAGATATTTGAGAATTTTTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAA--TGACTATGAGTTAAATTATAGACTCATTTATTTTACGGATTCCTTTT-CTATTGATTTTAAT-----------TTTATCCATAGACAGAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTAGAATTTGTCAAAAGAACAACTTTGTAAGTTTCAGTCTGTCTCATTCAAATGGAGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATCACATATGTG-ATATCCATGCGATGTGATAACAGAACAGTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAATCGC------------------------AGGATACGAGAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGATAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCGATT--------------------TTTTATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_anthemoides_ND120605_3 TCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATATCCTGTTAATGTGCG-TCTTTGGTCAGCCTCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTATGCATGAGACGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGATGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTTGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTCATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTC----ACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGG-TTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTCTATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_anthemoides_TD452 TCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCTCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTATGCATGAGACGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGATGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTTGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACC---------------TCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTCATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_arabicus_8134UPS TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCATGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTTGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATGTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------TTAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_arabicus_8850UPS TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCATGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCA-TCTTTGGTCAGCCCCTTGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------TTAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_arabicus_9438UPS TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCATGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTG{CT}G-TCTTTGGTCAGCCCCTTGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTC?TATCATGTTACGTCGTTCGCGGGGTTTGCATGATACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTT-GGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAAAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------TTAATATGGAATCAATTTATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_brachypodus_ND01 TCGAAACCTGCATAGCAGAACGACCCGTGGACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTATGCATGAGACGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGATGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTAACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAAAACGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAAAGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATAGTTAT------GTTCTATAATA Euryops_brachypodus_RM1108 TCGAAACCTGCATAGCAGAACGACCCGTGGACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCTCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTTGTATCATGTTACGTCGTTCGCGGGGTATGCATGAGACGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGATGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTAACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAAAACGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAAAGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATAGTTAT------GTTCTATAATA Euryops_brevilobus_ND010905_6 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGATATCCTGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTT-CTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_brownei_B248 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGT{AG}CG-TCTTTGGTCAGCCCTTTGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCC{CT}--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCACTTCGAAGGACGCACGAGTAGTGGTGGTTGCCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGGAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG----CCTGATGCCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT----------TTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTT-CTCTGAATTTGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_candollei_CC352 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCTGCCCCTAGGGTTC-TAATGATGTCACATCAAC-ACAATAACAAACCCCCGGCACGGTATGTGTCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ATAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTTGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAAGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTGAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_dacrydioides_UPS4377 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCTAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTTGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTACATGATGCGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTTGGTTGGCTAAAATA{AG}-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--AAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG----------------TCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT----------TTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_dacrydioides_UPSdacry TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCTAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTTGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTACATGATGCGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTTGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--AAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTTTTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT----------TTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_decumbens_CH09 TCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAATAA--CAATCGGTTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGTA-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAATTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATACATATAT-----ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAAAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATT-GAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_dregeanus_ND090905_6 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGTG-TCTTTGGT{CT}AGCCCTAAGGGTCC-TAATGATATCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTTTCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTATGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGTACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAAGTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTTAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGCTAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTTATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_dregeanus_ND090905_7 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGTG-TCTTTGGTTAGCCCTAAGGGTCC-TAATGATATCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTTTCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTATGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGTACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAAGTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAAA-TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTTAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGCTAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTTATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_empetrifolius_PRETO529 TCGAAACCTGCATAGCAGAACGACCCGCGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TTTTTGGTCAGCCCTTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGTTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTTGTGCGTTACAAGTAGCAGGGAA-GATCTCTTTAAAGACCCCAATGAGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG------------------CTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATAT-----------ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGA-------------------------------------------TTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_ericifolius_PALMER3934 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCA-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTATGCATGAGACGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTTTGATTGGGATGATGTAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCC-AATGTGTT-GTCT-TGTGACAATGCTTCGACC----TTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_ericoides_ND160705_3 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCA-TCTTTGGTCGGCCCCAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTCTCATGTTACGTCGTTCGCGGGGTATGCATGAGACGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGTTGATGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTTGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTTATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_euryopoides_YOUTHED751 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTCAATGTGCG-TCGTTGGTCGGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGTACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCT-CGACC---CTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG----------------------TTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCC----------------------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_evansii_CH04 TCGAAACCTGCATAGCAGAATGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCATAGGGTCC-TAATGATGTCACATTAAC-ATAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATAATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACTTCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGACTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGTACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTTAAAGACCCTAATGTGTT-GTCT-CGTGACAATGCTTCGACC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-ATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCTACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATAT-----------ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT-----ATAATATAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAA?ATAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATT-GAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_evansii_CH11 TCGAAACCTGCATAGCAGAATGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTATTGTGCG-TCTTTGGTCAGCCCATAGGGTCC-TAATGATGTCACATTAAC-ATAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATAATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGACTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGTACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTTAAAGACCCTAATGTGTT-GTCT-CGTGACAATGCTTCGACC------TCTTTTCTTCTCCCCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTTATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATAT-----------ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCA---------------------TTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_evansii_ND190106 TCGAAACCTGCATCGCAGAACGACCCGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTCCG-TCTTTGGTCAACCCCTAGGGTCC-CAATGGTGTCACATTAAC-ACAATAACAACCCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGATGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATTGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATATCTTCAAAGACCCCAATGTGTT-GTCT-CGTGGCAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTTATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_galpinii_ND081005_4 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGTG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--ATCGTGTGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_hebecarpus_ND160705_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--TAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCGGCCCCTAAGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTTTCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTTAAAGAACCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGATCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTTTGTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_hypnoides_TD4700 TCGAAACCTGCATAGCA?AACGACCCGTGAACATGTAATAA--CAATCGGGTCTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGAAACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATATCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTATGTCGTTCGCGGGGTATGCATGAGACGTGACTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGATGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGTGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAAAGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATT-GAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_lateriflorus_NB1487 TCGAAACCTGCATAGCAGAACGACCCGCGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTGATGTGCG-TTTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGTTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGCAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAAGTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTTAAAAGCCCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGCTAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTTATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_lateriflorus_ND040905_4 TCGAAACCTGCATAGCAGAACGACCCGCGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTT{AT}--GATTCTTTGGATACCCTGTTAATGTGCG-TTTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-A{CT}AATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCT{CT}GTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGCAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAATTTTAATTTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_lateriflorus_ND060905_11 TCGAAACCTGCATAGCAGAACGACCCGCGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TTTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTTGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGTTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTTAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGCAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACC-TTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAATTTTAATTTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_lateriflorus_ND130206 TCGAAACCTGCATAGCAGAACGACCCGCGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTGATGTGCG-TTTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGTTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGCAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAAGTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTTAAAAGCCCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGCTAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTTATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_lignifolius_ND140705_2 TCGAAACCTGCATAGCAGAGCGACCCGTGAACATGTAATAA--TAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCGGCCTCTAAGGTCC-TAATGATGCCACGTTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GTAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-CATCGGGATGGTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAA?G?ACGG?TGGCTTAAATA?-GA?TCCCCTTC?AAGGACGCAC?ATTAGTGGTGGGTGTCAAGAACTTCTTATCGA--CTCGTGCGTTACAAGTAGTAAGGAA-GATCTCTTCCAAGAACCTAATGTGTT-GTCT-TGTGACAATGCTTCGAACATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACGA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATGTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTT-GAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------AT--AATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_montanus_1XT5314 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGTTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGTA-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAATGTAAATAGTGCATGATGGAGCTCGGGTAGAAATTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATACATATATAATATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAAAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTATTTTCTT-----------TAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTTATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_multifidus_ND040905_3 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGTTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCA-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAAGTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTTAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGCTAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTTATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_munitus_BROWN130898 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTCAATGTGCG-TCTTTGGTCGGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ATAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACC---CTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAAATGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTTATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_othonnoides_ND010905_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGAAACCCTGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT----ACATGTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_othonnoides_ND120905_6 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGATATCCTGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTTTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCTTC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGAACTTCGTGCGTTACAAGTAGTAGGGAAAGATCTCTTCAAAGACCTTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT----------------CCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG-------GATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_pectinatus_ND290805_2 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTTCGACTT---TTGTAT--GATTCTTTGGATATCCTGTTATTGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCACGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAATGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACC---CTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT----ACATGTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCT-----------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_petraeus_CDM2 TCGAAACCTGCATAGCAGAACAACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGTG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAATCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCC---ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTTTTATCGA--CTCGTGCGTAACAAGTAGTAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACC----------------CCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------AGAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTATTGTTATGTTC-----TA Euryops_pinifolius_UPSpinni TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATACGTGGCTT{AC}TTT-ATAATCATAAA{CT}GACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ATAACATCTCTT-GATTGG{AG}ATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAA---TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT----------TTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_prostratus_Eth TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTTCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GACTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGGA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAA---TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTACTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTATATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT----------TTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_spathaceus_ND120605_2 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGAGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACTCTGTTATTGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ATAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACTATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAACGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGAATATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCTCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_spathaceus_ND120605_4 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGAGTGTCCAAGGTTTCCGACTA---TTGTTT--GATACTTTGGATACTCTGTTATTGTGCG-TCTTTGGTCAGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ATAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACATCGTTCGCGGTGTTTGCATGAAACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTTAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACTATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAACGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_speciosissimus_ND310805_4 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGATATCCTGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGAAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATCAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCC------TCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCTAAAAAT-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_speciosissimus_RM1058 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTT---TTGTTT--GATTCTTTGGATATC{AC}TGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCC-ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGTGTTACAAG{AT}AGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCCATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCGCTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAAAATATCTTAAATCAAAATAGTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCTTTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCC------TCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTAGAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------ATTTAATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCTAAAAAT-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_subcarnosus_ND080905_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACAG---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCTAAGGGTTC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGCGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAAGTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTTAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGCTAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTTATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_tenuissimus_ND020905_4 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATTCCCTGTTAATGTGCG-TCTTTGGTCGGCCTCTAAGGTCC-TAATGATGCCACGTTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GTAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-CATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGAACATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTGTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTGATTATTTCTTTAAT--------AT--AATATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_tenuissimus_ND130705_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATTCCCTGTTAATGTGCG-TCTTTGGTCGGCCTCTAAGGTCC-TAATGATGCCACGTTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GTAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-CATCGGGATGTTGGAACGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGAACATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----------TTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACACAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTTTATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATAGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAATTTATAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_trilobus_CDM3 TCGAAACCTGCATCGCAGAACGACCCGTGAACATGTAATAA--CAATTGGGTGTCCAAGGTTTCTGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-T{AC}TTTGGTCAACCCCTAGGGTCC-{CT}AATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGTGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GAT{CT}GGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGTTACGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTG{CT}GTTACA{GT}GTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCAAAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACTATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAG-------------------------TTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGTTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTAAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_tysonii_CH08 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATACCCTGTTAATGTGCG-TCTTTGGTCAGCCCCTAGGGT{CT}C-TAATGATGTCACAT{CT}AAC-ACA{AG}TAACAAACCCCCGGCACGG{CT}ATGTGTCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--A{CT}AACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACG?ACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT-----TTTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCGCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATATAT-----------ATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATT-GAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_ursinoides_TD4649 TCGAAACCTGCATAGCAGAACGACCTGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTACGACTA---TTGTTT--GATTCTTTGGATACCCTGTCAATGTGCG-TCTTTGGTCGGCCCCTAGGGTCC-TAATGATGTCACATTAAC-ACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTTACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAACGCCTTTTGGC{GT}GAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCCAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAAGCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTCTTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTT-GGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGA---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Euryops_virgineus_ND260805 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATAACCTGTTAATGTGCG-TCTTTGGTCAGCCCTTAGGGTCC-TAATGATGTCACATCAAC-ACAATAACAAACCCCCGGCACGGTATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTAACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGTTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAAGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-----ATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Euryops_virgineus_RM1023 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAA--CAATCGGGTGTCCAAGGTTTCCGACTA---TTGTTT--GATTCTTTGGATAACCTGTTAATGTGCG-TCTTTGGTCAGCCCTTAGGGTCC-TAATGATGTCACATCAAC-ACAATAACAAACCCCCGGCACGGTATGTGCCAAGGAAAATAAAACTTAA-GAAAAGCTCGTATCATGTAACGTCGTTCGCGGGGTTTGCATGAGACGTGGCTTCTTT-ATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCTGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACAACATCTCTT-GATTGGGATGTTGGAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGGTTGGCTAAAATAG-GAGTCCCCTTCGAAGGACGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGA--CTCGTGCGTTACAAGTAGTAGGGAA-GATCTCTTCAAAGACCCTAATGTGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAACAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAATCAAATCAAAATAGATTTTAAA--CGAGACATTAAAGACCACTCAATATATCTTAAATAAAAATATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTTAGGAAGCTAAAAAAA--TGACTATGAGTGAAATTCTAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTTTAAT------TTAATTTTATCCATAGACAAAATTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAATCTCATGCAGGTCCTATAATTTGTCAAAAGACCAACTTTGGAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-----------ATATCCATGTGATCTGATAACAGAACAGTATTTACGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGTTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTTAAT---------------ATAATATGGAATCAATTCATACCAATTCTT------CTGTATTATGTATA-CAAGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTCCTCTTT---------GTCTTTGATTTCTT-----ATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCTATAGTGATAAAAAATTTTAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Gymnodiscus_capillaris_LM110805_3 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAAAAA--TAACTTGGAGTCCGTGGTATCATTACG--TTT{AG}TTTT-GATTCCGTGGATTCCTTGTTGATGTGCG-TCCTTTGTTACG---------------------CACATTGGCAAACACAAC-AACCCCCGGCACGGAACGTGCCAAGGAAAATTAAACTTAA--AAGGGATCGT-CCAAGTGTCCTCGTCCGCGAGGATTTCATGGAATGATGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCC--AACTACATCTTTTAAACGAGGATGTTGTGTTGGGGGCGGATACTGGTCTCCCGTACATGT-GTGCGGTTGACTAAAATAC-GAGTCCCCTTCGATGGACGCACGATTAGTGGTGGTTGTTAAGACCCTCTTATCGA--GTCGTGTGTTACAAGGAGTAAGGAA-GATCTCTCTAAAGACCCCAAGTTGTT-GTCA-CTTGACGACGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCGGGGGGG-CGACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAATTGTTGGAAGGGTTAAAACTTTTTCGATTCACCGTGTATCGCGCACGAATTAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCTATTGTCTCACGGATCCGAATAAAGAA-----TCAAAATAGATTTTTAA--TGAGACATTAAAGACCACTCAAAATATCTTAAAGATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAAAATGACTATGAGCGAAATTATAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCGTAGACAAAACTTCTAATCATTTTT-TCTTGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTACTGATGT------CTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAGTCTCATGCGGGTCCTATAATTTGTCAAAAGAACAACTTTGTAAGTA-------ATATCATTCAAATGGGGATTCCTTGCTCAAAT-TGTACATT-GTACAT--------GTATCATTAT----------ATATTCATGTGATGTGATAACAGAACAGTATTTCC---------CATTT---------GTAGTGAATGAGAAAGATAAGGAGTTTTGAACTGCTAATGAAAAAA-GTATAAATAAAAAGGATACGATAAATAATAATTAGTTAGGGAATCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCAACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATTGAATGGATATTTGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTGATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTCTAGCGGAACAGTTGAATTCATTAT------ATAGATGGCG-ATTCCTGTCTCTAAAAA-GTGTTTTCTTCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATA-TAGGAGGCTC--ATATTCAGCCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCATAAACATCTCTCTCTCTCTTCCACTCCACCCCTTTACCCCAAAAA-TTTAAAATACTTGAACGGTCGATT----------TTTTGAAATTCTATATCGCTACATTAATTGTTATTGTTATGTTCTATAATA Gymnodiscus_capillaris_ND300805_1 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAAAAA--TAACTTGGCGTCCGTGGTATC--ATTACGTTTGTTTC-GATTCCATGGATTCCTTGTTGATGTGCGTCCTTTGTTACG----------------------CACATTGGCAAACACAAC-AACCCCCGGCACGGAACGTGCCAAGGAAAATTAAACTTAA--AAGGGATCGT-CCAAGTGTCCTCGTCCGCGAGGATTTCATGGAATGATGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCC--AACTACATCTTTTAAACGAGGATGTTGTGTTGGGGGCGGATACTGGTCTCCCGTACATGT-GTGCGGTTGACTAAAATAC-GAGTCCCCTTCGATGGACGCACGATTAGTGGTGGTTGTTAAGACCCTCTTATCGA--GTCGTGTGTTACAAGGAGTAAGGAA-GATCTCTCTAAAGACCCCAAGTTGTT-GTCA-CTTGACGACGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCGGGGGGGGCGACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAATTGTTGGAAGGGTTAAAACTTTTTCGATTCACCGTGTATCGCGCACGAATTAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCTATTGTCTCACGGATCCGAATAAAGAA-----TCAAAATAGATTTTTAA--TGAGACATTAAAGACCACTCAAAATATCTTAAAGATTTTTATTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAAAATGACTATGAGCGAAATTATAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCGTAGACAAAACTTCTAATCATTTTT-TCTTGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTACTGATGT------CTCATTTTCATTTTACTAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAGTCTCATGCGGGTCCTATAATTTGTCAAAAGAACAACTTTGTAAGTA-------ATATCATTCAAATGGGGATTCCTTGCTCAAAT-TGTACATT-GTACAT--------GTATCATTAT----------ATATTCATGTGATGTGATAACAGAACAGTATTTCC---------CATTT---------GTAGTGAATGAGAAAGATAAGGAGTTTTGAACTGCTAACGAAAAAA-GTATAAATAAAAAGGATACGATAAATAATAATTAGTTAGGGAATCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCAACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATTGAATGGATATTTGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTGATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTCTAGCGGAACAGTTGAATTCATTAT------ATAGATGGCG-ATTCCTGTCTCTAAAAA-GTGTTTTCTTCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATA-TAGGAGGCTC--ATATTCAGCCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCATAAACATCTCTCTCTCTCTTCCACTCCACCCCTTTACCCCAAAAA-TTTAAAATACTTGAACGGTCGATT----------TTTTGAAATTCTATATCGCTACATTAATTGTTATTGTTATGTTCTATAATA Hertia_pallens TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAACAA-ACAA--------------------------------------------------CGGTCGATGTGCG-TCTTTGGTCAGCCCTTTGGGTTC-CAAGGATATCACATTGAC-ACAATAAC-AACCCCCGGCACGGCATGTGCCAAGGAAAAATAAACTTAA-GAAGGGCTTGTACCATGTTTCCTCGTTCGCGGGGTTTTCATGGGACGTGGCTTCTTT-ATAATAACAAACGACTCTCGACAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGTCTGGGCGTCACATATCGCGTCGCCCC---CACCACATCTCTA-TATGGAGATGTTGGAAT-GGGGCGGAGATTGGTCTCCCGTTCCTATGGTGCGGTTGGCTAAAATAA-GAGTCCCCTTCGATGGACGCACGATTAGTGGTGGTTGAAAAGACCCTCTTATCAA--GTTGTGCGTTACAAGGAGTAAGGAA-GATCTCTTCAGA-ACCCCAATGCGTT-GTCT-TTTGACAATGCTTCGATCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAATTGTTGGAAGGGTTCAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAA-----TCAAAATCGATTTTAAA--CGAGACATTAAAGACCACTCAATATAGATTAAAGAAAAATATTTAAGGTATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAA--TGACTATGAGTTAAATTATAGACTCATTTATTTTACGGATTCCTTTTTCTATTTATTTTCAT-----------TTTTTCCATAGACAAAATTTCTAATCATTTTTT-CTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCCGATGTCTCATCCTCATTTTCATTTTAATAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAGTCTCATGCGGGTCCTATAATTTGTCAAAAGAACAACTTTGTAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAAGATGTTCATTTATACAT--------GTATCATAT-------------ATCCATGTGATGTGATAACAGAACAGTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTTAACCGTTAATGCAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTATTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATATCAGATTTATCCTTCATCTTTTCTGAAGTTTCCATAGAAGGATTCCTATACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-CTGTTTTCTCCTCTTT---------GTTTTTGATTTCTT-GTCTATCTTCTTTCATATTCTATAATAGAAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCTGCAATTCAATATAGGTAGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCAAAAAA-TTTCAAATACTTGAACGGTCGATTGTGATAAAAAATTTGAAATTATATATCGCTACATTAATTGTTAT------GTTCTATAATA Othonna_carnosa_ND120605_1 TCGAAACCTGCCTAGCAGAACGACCCGCGAACATGTAACAC--TAATCGGGTGTCCAAAACGTC--ATGACTTTTGCTT--GATTATTTGGACGCCTTGTTGACGTGCT-TCTTTGGTTAGCCCTTTGGGCCC-CAAGGATGTCACGTTGGC-AACTCAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATTAAACTTAA--AAGGGCTCTT-CCATGTTTCCTCGTTCGCGTGGTCTTCATGGAATGATGCATCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCC---AACCACACCTCCTT-ACGGGGATGTTGTTATTGGGGCGGAGATTGGTCTCCCGTTCGTAAGGTGCGGTTGGCTAAAATAG-GAGTCCCCTTTGATGGACACACGACTAGTGGTGGTTGTTAAGACCCTCTTATCGA--GTCGCGTGTTTTAAGGAGTAGGGAA-AGCCTCAATAAAGACCCCAATGCGTT-GTCT-TGTGACAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAATGCTCTTGGCTCGACATCGTTTGTTCTATTTTACTA--GAACCTCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAAATGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAA-----TTAAAATAGATTTTAAA--CGAGACATTAAAGACTACTCAATATATCTT-----AAAATCTTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAAA-TGACTATGAGTTAAATTAGAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCATAGATAACACTTCTAATCATTTTTATCTCGAGCCGTACGAGGAGAAAAC----------------------TATTCCTGATGTCTCATCCTCATTTTCATTTTAATAGAGAACGTGCGTCTATGTCAATTCAAAGGGTATTTCAAAGTCTCATGCAGGTCCTATAATTTGTCAAAAGAACAA--------GTTTCAGTCTGTATCATTCAAATGGGGATTCCTTGCTCAACAATGTTCATTTGTACAT--------GTATCAT-------------ATATCCATGTGATGTGATAACAGAACAGTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGGGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAAAAA-------TTAGGAAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCGTATTATGGAGTGAATGATTTGATC-AATGGATATTCGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCAATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGTAACAGTTGAATTCATTAGATATAGATAGATGAATGATTCCTGTCTCGAAAAAAGTGTTTTCTTCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCA--TTCTATA-TAGGGGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAACCATCTGTCTCTCTTT-------CACTCCTTTCCCCCAAAAA-TGAAAAATACTTGAACGGTCAATT----------TTTTT-----CTATATCGCTACATTAATTGTTATTGTTATATTCTATAATA Othonna_eriocarpa_NB1938 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAACAA-ACAA--------------------------------------------------TCG{CT}C{AG}ATGTGCG-TC-TTATC-AGCCCTTTGGGTTC-TAAGGATGTCACATTGGC-ACAATAAC-AACCCCCGGCACGGCATGTGCCAAGGAAAATCAAACTTAA-GAAGGGCTCGTACCATGTTTCCTCGTTCGCGGGGTTTGCATGGGATGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCATGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCG{AG}AGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACCACATCTC{AT}A-TATTGGGATGCTGGAGT-CGGGCGGAGATTGGTCTCCCGTTCCCAAGGTGCGGTTGGCTAAAAAAAAGAGATCCCTTCGATGGACGCACGATTAGTGGTGGTTGACAAGACCCTCTTATCAA--GTCGTGCGTTATAAGGAGTAAGGAT-GA-CTCTTCTAAAACCCCAATGTGTC-GTCT-TCGGACGATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACGTCGTTTGTTCTATTCTACTA--GAACCCCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATTGAAAGGATCCGATTCGAGCAAATTGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGCTTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTTAAA-AAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAA-----TTACAATAGATTTTAAA--TGAGACATTAAAGACCACTCAATATATTTTAAAGATTTTTCTTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAA--TGACTATGAGTTAAATTATAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCATAGACAAAACTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAATGTGCGTCTATGTCAATTGAAAGGGTATTACAAAGTCTCATGCAGGTCCTATAATTTGTCAAAAGAACAACTTTGTAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAA--------------CAT--------GTAT--TAT-----------ATATCCATGTGATGTGATAACAGAACACTATTTCGGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GTATAAATCAAAAGGATACGATAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAAATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTTTTTCTTCTGTATTATATATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCTGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGGAACAGTTGAATTCATTAG------ATAGATGGCG-ATTCCTGTCTCGAAAAA-GTGTTTTCTTCTCTTT---------GTCTTTGAT------GTCTATCTTCTTTCATATTCTATA-TAGGAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAAACATCTGTCTCTCTTC-------CACTCCTTTCCCCCAAAAAATTTCAAATACTTGAACGGTCGATT-----------------TTTCTATATCGCTACATTAATTGATATTGTTATGTTCTATAATA Othonna_euphorbioides_ND060905_3 TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAACGCAA--------------------------------------------------TCGCTGATGTGCG-TCGTTAGC-GGCCCTTTGGGTTC-TAAGGATGTCACATTGGC-ACAATAAC-AACCCCCGGCACGGCATGTGCCAAGGAAAATCAAACTTAA-GAAGGGCTCGTACCATGTTTCCTCGTTCGCGGGGTTTGCATGGGATGTGGCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCC--ACCACATCTCTA-TATTGGGATG{CT}TGGAGT-CGGGCGGAGAATGGTCTCCCGTTCCTAAGGTGCGGTTGGCTAAAAAAA-GAGTTCCCTTCGATGGACGCACGATTAGTGGTGGTTGACAAGACCCTCTTATCAA--GTCGTGCGTTATAAGGAGTAAGGAA-GATCTCTTCTAAAACCCCAATGTGTTTGTCT-TCGGACAATGCTTCGACC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????----CCTGATGTCTCATCCTCATTTTCATTTTACTAGAGAATGTGCGTCTATGTCAATTGAAAGGGTATTACAAAGTCTCATGCAGGTCCTATAATTTGTCAAAAGAACAACTTTGTAAGTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAAA--------------CAT--------GTAT--TAT-----------ATATCCATGTGATGTGATAACAGAACACTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGAGTTTTGAACCGCTAACGAAAAAA-GTATAAATCAAAAGGATACGCTAAATAA-------TTAGGGAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAAATCTATCAGATTATGGAGTGAATGGTTTGATC-AATGGATATTCGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTTTTTCTTCTGTATTATATATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCTGGGTTTCTCTGAATTTGAAAG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Othonna_sedifolia_LM060605_13 TCGAAACCTGCCTAGCAGAACGACCCGTGAACATGTAACAC--TAATCGGGTGTCCAAAACGTCA-TGAC-TTTTGCTT--GATTATTTGGACGCCTTGTTGATGTGCT-TCTTTGGTTAGCCCTTTGGGCCC-CAAGGATGTCACGTTGGC-AACTCAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATTAAACTTAA--AAGGGCTCTT-CCATGTTTCCTCGTTCGCGTGGTCTTCATGGAATGATGCATCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCC---AACCACACCTC-ATTACGGGGATGTTGTTATTGGGGCGGAGATTGGTCTCCCGTTCGTAAGGTGCGGTTGGCTAAAATAG-GAGTCCCCTTTGATGGACACA{AC}GACTAGTGGTGGTTGTTAAGACCCTCTTATCGA--GTCGCGTGTTTTAAGGAGTAGGGAA-AGCCTCTATAAAGACCCCAATGCGTT-GTCT-TGTGACAGTGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAATGCTCTTGGCTCGACATCGTTTGTTCTATTTTACTA--GAACCTCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAAATGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAA-----TCAAAATAGATTTTAAA--CGAGACATTAAAGACTACTCAATATATCTT-----AAAATCTTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAAA-TGACTATGAGTTAAATTAGAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCATAGATAACACTTCTAATCATTTTTATCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTAATAGAGAACGTGCGTCTATGTCAATTCAAAGGGTATTTCAAAGTCTCATGCAGGTCCTATAATTTGTCAAAAGAACAA--------GTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAACAATGTTCATTTGTACAT--------GTATCAT-------------ATATCCATGTGATGTGATAACAGAACAGTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGGGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAAAAA-------TTAGGAAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCGTATTATGGAGTGAATGATTTGATC-AATGGATATTCGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCAATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGTAACAGTTGAATTCATTAGATATAGATAGATGAATGATTCCTGTCTCGAAAAAAGTGTTTTCTTCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCA--TTCTATA-TAGGGGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAACCATCTGTCTCTCTTT-------CACTCCTTTCCCCCAAAAA-TGAAAAATACTTGAACGGTCAATT----------TTTTT-----CTATATCGCTACATTAATTGTTATTGTTATATTCTATAATA Othonna_sedifolia_ND050905_1 TCGAAACCTGCCTAGCAGAACGACCCGTGAACATGTAACAC--TAATCGGGTGTCCAAAACGTCA-TGAC-TTTTGCTT--GATTATTTGGACGCCTTGTTGATGTGCT-TCTTTGGTTAGCCCTTTGGGCCC-CAAGGATGTCACGTTGGC-AACTCAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATTAAACTTAA--AAGGGCTCTT-CCATGTTTCCTCGTTCGCGTGGTCTTCATGGAATGATGCATCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCC---AACCACACCTC-ATTACGGGGATGTTGTTATTGGGGCGGAGATTGGTCTCCCGTTCGTAAGGTGCGGTTGGCTAAAATAG-GAGTCCCCTTTGATGGACACACGACTAGTGGTGGTTGTTAAGACCCTCTTATCGA--GTCGCGTGTTTTAAGGAGTAGGGAA-AGCCTCTATAAAGACCCCAATGCGTT-GTCT-TGTGACAGTGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAATGCTCTTGGCTCGACATCGTTTGTTCTATTTTACTA--GAACCTCTCGGTTGTAATGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAAATGTTGGAAGGGTTAAAACTTTTTCGATCCACAGTGTATCGCGCACGAATCAACCGTATGATTCTTTGATAGAAAGAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAACACCACTTCAATTGTCTCACGGATCCGAATAAAGAA-----TCAAAATAGATTTTAAA--CGAGACATTAAAGACTACTCAATATATCTT-----AAAATCTTTAAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTTCAGGAAGCTAAAAAAAA-TGACTATGAGTTAAATTAGAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCATAGATAACACTTCTAATCATTTTTATCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATGTCTCATCCTCATTTTCATTTTAATAGAGAACGTGCGTCTATGTCAATTCAAAGGGTATTTCAAAGTCTCATGCAGGTCCTATAATTTGTCAAAAGAACAA--------GTTTCAGTCTGTCTCATTCAAATGGGGATTCCTTGCTCAACAATGTTCATTTGTACAT--------GTATCAT-------------ATATCCATGTGATGTGATAACAGAACAGTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGGGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAAAAA-------TTAGGAAGTCAAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAACGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCGTATTATGGAGTGAATGATTTGATC-AATGGATATTCGATTCTTTCTTCAAT--------------------ATGGAATCGATTCATACCAATTCTT------CTGTATTATGTATA-CAGGTTTATCCTTCATCTTTTCTGAAGTTTCAATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTATTAATTCCAGGGTTTCTCTGAATTTGAAAGTTTCATTTATAGCGTAACAGTTGAATTCATTAGATATAGATAGATGAATGATTCCTGTCTCGAAAAAAGTGTTTTCTTCTCTTT---------GTCTTTGATTTCTT-GTCTATCTTCTTTCA--TTCTATA-TAGGGGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGGTGGATACATACCCTAACCATCTGTCTCTCTTT-------CACTCCTTTCCCCCAAAAA-TGAAAAATACTTGAACGGTCAATT----------TTTT------CTATATCGCTACATTAATTGTTATTGTTATATTCTATAATA Othonna_spnov_LM210903_6 TCGAAACCTGCATAGCAGAACGACCCGTGAACACGTAACAA--CAACAGGGTATCCAACGTATCATTGACTCTGGTTTTT-GATCGTTTGGATGCCTTGTCGATGTGTTGTCCTTGGTCAGACCTTCGGTCCC-TAAGGACGTCACATTGAC-AACACAAC-AACCCCCGGCACGGAATGTGCCAAGGAAAATTAAACTTAA-AAAGGTCTCGT-CCATGTTTCCTCGTTCGCGGGGTATACACGGAATGAGTCTTCTTT-ATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCC--AACCTCGTCTCTTTTACGGGGATGTTGGTCCGGGGGCGGAGAATGGTCTCCCGTACCTAAGGTGCGGTTGGCTAAAATAG-GAGTCCCCTTCGATGGACGCACGATTAGTGGTGGTTGTTAAGACCCTCTTACCGA--GTTGTGCGTTATAAGAAGCGAGGAA-GATCTCTTTAAAGACCCCAACGTGTT-GCCC-TGTGGCAATGCTTCGACCATTCTTATTCTTACATCCACCATTTTATATAGGAATGAAAGTGCTCTTGGCTCGACATCATTTGTTCTATTCTACTA--TAATCCTTCGGTTGTCGTGTAA-----ATAGTGCATGATGGAGCTCGGGTAGAAAGTATTTATTAATTTCTCAGGGG---CAACGATCTAGGGTTAATGCCAATCAATAAATTGGAACAACTTCGTAAGTATATCTTCGATATAGAAATCGAAAGGATCCGATTCGAGCAAAATGTTGGAAGGGTGAAAACTTTTTCGATCGACAGTGTATCACGCACGAATCAACCATATGATTCTTTGATAGAAATAAATCACAAAAGGGGTATGTTGCTACCATTTTGAAAGGATTAAGAAGCACCGAAGTAATGTCTAAACCCAATGATTTAAAACAAAGATAAAGGATCCCAGAACAAGGAAATACCACTTCAATTGTCTCAAGGATCCGAATAAAGAA-----TCAAAATAGATTTTAAA--TGAGACATTAAAGACCACTCAAAATATCTTAAAGATTTT-----AAGATATTTGAGAATTATTGAACTTGAGTTATGAGTACAAATGATTTTTTGCAGTAAGCTAAAAAAA--TGACTATGAGTTAAATTATAGACTCATTTATTTTACGGATTCCTTTT-CTATTTATTCTAAT-----------TTTATCCATAGACAAAACTTCTAATCATTTTTTTCTCGAGCCGTACGAGGAGAAAACTTCCTATACGGTTCTAGGGGGGTATTCCTGATATCTCATCCTCATTTTCATTTTAATAGAGAACGTGCGTCTATGTCAATTGAAAGGGTATTACAAAGTCT--------TCCTATAATTTGTCAAAAGAACAACTTTGTAAGTTTCAGCCTGTCTCATTCAAATGGGAATTCCTTGCTCAACGATGTTCATTTGTCCAT--------GTATCAT-------------ATATCCATGTGATGTGATAACAGAACAGTATTTCCGTTCAGATCCATTTGTATAAAGAGTAGTGAATGAGAAAGATAAGGGGTTTTGAACCGCTAACGAAAAAA-GGATAAATCAAAAGGATACGATAAATAA-------TTAGGAAGTCGAATGGTCTTTTTGGGGATAGAGGGACTTGAACCCTCACGATTTTTGAAATCGACGGATTTTCCTCTTACTATAAATTTCATTGTTGCCGGTATTGACATGTAGAATGGGACTCTATCTTTATTCTCGTCCGACAGTTCTTCAAAAGATCTATCGTATTATGGAGTGAATGATTTGATC-AATGGATATTCGATTCTTTCTTCAAT--------------------ATGGAATC---------CAATTCTT------CTGTATTCTGTATA-CAGGTTTATCCTTCATCTTTTTTGAAGTTTCGATAGAAGGATTCCTCTACCAATGTAAGACAATCAACTCCATTCGTTAGAACAACTTCCATCGAGTCTCTGCACCTATCCTTTTTTATTTTCGCTTTCTGAACCTTTGTTTGTTTTCGGAAAACGTGATTTGGCTCAGGATTACCCATTTTTA--------------------------------------------------------------------------------ATTCCTGTCTCGAAAAA-GTGTTTTCTTCTCTTTCTTCTCTTTGTTCTT---------GTCTATCTTCTTTCA--TTCTATAATAGGAGGCTC--ATATTCGGTCCAATCAAAAACTATTTTATCATTTCTGTATCCGCAATTCAATATAGATGGATACATACCCTAACCATCTGTCTCTCTTT-------AACTCCTTTCCCCCAAAAA-TTTAAAATACTTGAATGGTCGATT--------------------CTATATCGCTACATTAATTGTTATTGTTCTATTCTATAATA ; END; BEGIN SETS; CHARSET cpDNA (CHARACTERS = ITS_Plus_cpDNA_combined) = 663-2611; CHARSET ITS (CHARACTERS = ITS_Plus_cpDNA_combined) = 1-662; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = ITS_Plus_cpDNA_combined) = N: 1-2611; CODONPOSSET * CodonPositions (CHARACTERS = ITS_Plus_cpDNA_combined) = N: 1-2611; END; BEGIN TREES; TITLE Tb10382; LINK TAXA = Taxa1; TRANSLATE 1 Euryops_algoensis_NB1908, 2 Euryops_lateriflorus_NB1487, 3 Othonna_eriocarpa_NB1938, 4 Euryops_brachypodus_ND01, 5 Euryops_othonnoides_ND010905_1, 6 Euryops_annuus_ND010905_4, 7 Euryops_brevilobus_ND010905_6, 8 Euryops_tenuissimus_ND020905_4, 9 Euryops_multifidus_ND040905_3, 10 Euryops_lateriflorus_ND040905_4, 11 Othonna_sedifolia_ND050905_1, 12 Euryops_lateriflorus_ND060905_11, 13 Othonna_euphorbioides_ND060905_3, 14 Euryops_subcarnosus_ND080905_1, 15 Euryops_galpinii_ND081005_4, 16 Euryops_dregeanus_ND090905_6, 17 Euryops_dregeanus_ND090905_7, 18 Othonna_carnosa_ND120605_1, 19 Euryops_spathaceus_ND120605_2, 20 Euryops_anthemoides_ND120605_3, 21 Euryops_spathaceus_ND120605_4, 22 Euryops_othonnoides_ND120905_6, 23 Euryops_lateriflorus_ND130206, 24 Euryops_tenuissimus_ND130705_1, 25 Euryops_abrotanifolius_ND130705_2C, 26 Euryops_lignifolius_ND140705_2, 27 Euryops_hebecarpus_ND160705_1, 28 Euryops_ericoides_ND160705_3, 29 Euryops_abrotanifolius_ND160705_5, 30 Euryops_evansii_ND190106, 31 Euryops_virgineus_ND260805, 32 Euryops_abrotanifolius_ND280805_1, 33 Euryops_pectinatus_ND290805_2, 34 Gymnodiscus_capillaris_ND300805_1, 35 Euryops_speciosissimus_ND310805_4, 36 Euryops_abrotanifolius_ND310805_6, 37 Hertia_pallens, 38 Euryops_ericifolius_PALMER3934, 39 Euryops_virgineus_RM1023, 40 Euryops_abrotanifolius_RM1056, 41 Euryops_speciosissimus_RM1058, 42 Euryops_brachypodus_RM1108, 43 Euryops_anthemoides_TD452, 44 Euryops_ursinoides_TD4649, 45 Euryops_hypnoides_TD4700, 46 Euryops_dacrydioides_UPS4377, 47 Euryops_dacrydioides_UPSdacry, 48 Euryops_pinifolius_UPSpinni, 49 Euryops_euryopoides_YOUTHED751, 50 Euryops_abrotanifolius_ND310805_1, 51 Euryops_evansii_CH11, 52 Euryops_tysonii_CH08, 53 Euryops_decumbens_CH09, 54 Euryops_acraeus_CH05, 55 Euryops_evansii_CH04, 56 Euryops_empetrifolius_PRETO529, 57 Euryops_montanus_1XT5314, 58 Euryops_brownei_B248, 59 Euryops_arabicus_8134UPS, 60 Euryops_arabicus_8850UPS, 61 Euryops_arabicus_9438UPS, 62 Euryops_munitus_BROWN130898, 63 Euryops_candollei_CC352, 64 Euryops_petraeus_CDM2, 65 Euryops_trilobus_CDM3, 66 Euryops_annae_CDM4, 67 Euryopoides_DOUBELL29, 68 Euryops_prostratus_Eth, 69 Othonna_sedifolia_LM060605_13, 70 Gymnodiscus_capillaris_LM110805_3, 71 Othonna_spnov_LM210903_6; TREE Fig._3 = [&R] (70,(34,(((((((((57,53),9),(64,((66,(((2,23),12,56),10)),(19,21))),(65,30),(((8,24),26),27),(51,55)),((5,(7,22,33,35,41),(25,50)),14,(16,17),(29,32,(36,40)))),(((58,(59,60,61),(46,47)),48),68),(62,(67,49),44),(((63,52),(1,(31,39))),54),((4,42),(20,43),28,38,45),15),6),((3,13),37)),((69,11),18)),71))); END; BEGIN TREES; TITLE Tb10381; LINK TAXA = Taxa1; TRANSLATE 1 Euryops_algoensis_NB1908, 2 Euryops_lateriflorus_NB1487, 3 Othonna_eriocarpa_NB1938, 4 Euryops_brachypodus_ND01, 5 Euryops_othonnoides_ND010905_1, 6 Euryops_annuus_ND010905_4, 7 Euryops_brevilobus_ND010905_6, 8 Euryops_tenuissimus_ND020905_4, 9 Euryops_multifidus_ND040905_3, 10 Euryops_lateriflorus_ND040905_4, 11 Othonna_sedifolia_ND050905_1, 12 Euryops_lateriflorus_ND060905_11, 13 Othonna_euphorbioides_ND060905_3, 14 Euryops_subcarnosus_ND080905_1, 15 Euryops_galpinii_ND081005_4, 16 Euryops_dregeanus_ND090905_6, 17 Euryops_dregeanus_ND090905_7, 18 Othonna_carnosa_ND120605_1, 19 Euryops_spathaceus_ND120605_2, 20 Euryops_anthemoides_ND120605_3, 21 Euryops_spathaceus_ND120605_4, 22 Euryops_othonnoides_ND120905_6, 23 Euryops_lateriflorus_ND130206, 24 Euryops_tenuissimus_ND130705_1, 25 Euryops_abrotanifolius_ND130705_2C, 26 Euryops_lignifolius_ND140705_2, 27 Euryops_hebecarpus_ND160705_1, 28 Euryops_ericoides_ND160705_3, 29 Euryops_abrotanifolius_ND160705_5, 30 Euryops_evansii_ND190106, 31 Euryops_virgineus_ND260805, 32 Euryops_abrotanifolius_ND280805_1, 33 Euryops_pectinatus_ND290805_2, 34 Gymnodiscus_capillaris_ND300805_1, 35 Euryops_speciosissimus_ND310805_4, 36 Euryops_abrotanifolius_ND310805_6, 37 Hertia_pallens, 38 Euryops_ericifolius_PALMER3934, 39 Euryops_virgineus_RM1023, 40 Euryops_abrotanifolius_RM1056, 41 Euryops_speciosissimus_RM1058, 42 Euryops_brachypodus_RM1108, 43 Euryops_anthemoides_TD452, 44 Euryops_ursinoides_TD4649, 45 Euryops_hypnoides_TD4700, 46 Euryops_dacrydioides_UPS4377, 47 Euryops_dacrydioides_UPSdacry, 48 Euryops_pinifolius_UPSpinni, 49 Euryops_euryopoides_YOUTHED751, 50 Euryops_abrotanifolius_ND310805_1, 51 Euryops_evansii_CH11, 52 Euryops_tysonii_CH08, 53 Euryops_decumbens_CH09, 54 Euryops_acraeus_CH05, 55 Euryops_evansii_CH04, 56 Euryops_empetrifolius_PRETO529, 57 Euryops_montanus_1XT5314, 58 Euryops_brownei_B248, 59 Euryops_arabicus_8134UPS, 60 Euryops_arabicus_8850UPS, 61 Euryops_arabicus_9438UPS, 62 Euryops_munitus_BROWN130898, 63 Euryops_candollei_CC352, 64 Euryops_petraeus_CDM2, 65 Euryops_trilobus_CDM3, 66 Euryops_annae_CDM4, 67 Euryopoides_DOUBELL29, 68 Euryops_prostratus_Eth, 69 Othonna_sedifolia_LM060605_13, 70 Gymnodiscus_capillaris_LM110805_3, 71 Othonna_spnov_LM210903_6; TREE Fig._2 = [&R] (70,(34,((((((57,53),(64,66),((2,23),9,14,16,17),(5,7,22,(((25,50),(35,41),(36,40)),29,32),33),8,24,26),((58,(59,60,61),68,(46,47),48),65,(10,12,56),30,(51,55),54),(62,67,(4,42,45),(19,21),(20,43),27,28,38,44,49),(63,1,(31,39)),15,52),6),37),((69,11,18),71),(3,13)))); END;