#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 14:51 GMT TreeBASE (cc) 1994-2008 Study reference: Abdel-wahab M.A., Nagahama T., & Abdel-aziz F. 2009. Two new Corollospora species and one anamorph based on morphological and molecular data. Mycoscience, 50(3): 147-155. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S9989] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=26; TAXLABELS Aniptodera_chesapeakensis_U46882 Arenariomyces_trifurcatus_AF491277 Corollospora_anglusa_AB361008 Corollospora_cinnamomea_AB361017 Corollospora_gracilis_AB361018 Corollospora_gracilis_AB361019 Corollospora_lacera_AF491259 Corollospora_luteola_DQ104809 Corollospora_maritima_AB361011 Corollospora_maritima_AF491260 Corollospora_maritima_U46884 Corollospora_portsaidica_AB361016 Corollospora_pulchella_AF491274 Cucullosporella_mangrovei_AY150219 Daldinia_concentrica_U47828 Hypoxylon_subgilvum_DQ840068 Microascus_trigonosporus_U47835 Nais_inornata_AF539476 Nemania_diffusa_DQ840076 Neptunella_longirostris_AF539472 Okeanomyces_cucullatus_AY490787 Rosellinia_corticium_DQ840078 Sagaaromyces_abonnis_AF539469 Varicosporina_ramulosa_AB361020 Varicosporina_ramulosa_U44092 Xylaria_hypoxylon_U47841 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4450] TITLE LSU_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=696; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aniptodera_chesapeakensis_U46882 TTGTAATTTGCAGAGGATCTTCTGCGCGGTGCCTTCCGAGTTCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTCGGTAACTAAGCTATTGTGTAGCACCTTCGACGAGTCGAGTAGTTTGGGAAT?CTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTGGGCCTGGTAGTCAGCCGTCCTTCTGGGCGGTGCATTCTGCCGGTCAGCCACATCAGTTGTCGGTTGGGGAGAAATGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCATTATGCCCTGGCGACTGAGGTTAGCGTACGGATCTGCGTAATGGTCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCATCCTATATCGAGTGTTTGGGTGTCAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATTGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATATTGGGCTGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Arenariomyces_trifurcatus_AF491277 TTGTAATTTACAGAGGATCTTTGGCGAGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGTCTGGCGCCGAGCCTCTGTAAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTAAACTCCTCCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCGGCCAGACCGGGCCCGGTAGTCAGCCGTCCCTCGGGGCGGTGCACTCTGCCGGCCAGCCACATCGGTTCTCGGCGGGGGAGAAACGGTGGGAACGTGGCTCCTCGGAGTGTTATACCCCCGCCATGCCTCG?CGACCGTGGTCCGCGCAAGGATCT?CGTAATG?CCACCACGACCCGTCTTGAAACACGGACCAAGGAGTCATCCTATATCGAGTGTTCGGGCGTCAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTCTTCGGATGGATTGAGTAGGACATACTGGGCTGTACCCGAAAGAAGGTGACTATCTTGGATAGGTGAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_anglusa_AB361008 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTGCCTGGAACGGGCCGCCGCAGAGGGTGAGAGCCCCGTACGGTAGGATGCCGAGCCGGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCGGTCAGCCGTCCCTCGGGGCGGTGCACTCTGCCGGCCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGTTATGCCCCGCGGGCTGAGGTTCGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCAAAACCCTACGCGCAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_cinnamomea_AB361017 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTGCCTGGAACGGGCCGCCGCATAGGGTGAGAGCCCCGTACGGTCGGACGCCGAGCCGGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCGGCTCAGCCGTCCTCGGGGCGGTGCACTCCGCCGGCCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGCTACGCCCCGCGGGCTGAGGTCCGCTCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTAGGGTGCAAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAAGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_gracilis_AB361018 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTGCCTGGAACGGGCCGCCGGAGAGGGTGAGAGCCCCGTACGGTCGGATGCCGAGCCAGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCGGTCAGCCGTCCCTCGGGGCGGTGCACTCCGCCGGCCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGTTACGCCCCGCGGGCTGAGGTACGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCAAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_gracilis_AB361019 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTGCCTGGAACGGGCCGCCGGAGAGGGTGAGAGCCCCGTACGGTCGGATGCCGAGCCAGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCGGTCAGCCGTCCCTCGGGGCGGTGCACTCCGCCGGCCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGTTACGCCCCGCGGGCTGAGGTACGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCAAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_lacera_AF491259 TTGTAATTTGCAGAGGATCCCTGGCGAGGCGCCTGCCGAATTCCTGGAACGGGACGCCGTGGAGGGTGAGAGCCCCGTGCGGCCGGCCGCCGAGCCTCTGTGGGGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGGCCAGACTGCGGCCGGCAGCTCACCGCCCCTCGGGGCGGTGCACTCTGCCGGCCAGCCACATCGGTTCGCGGCGG?GGAGAA?CGGCGGGAACGTGGCTTCTAGGAGTGTTACACCCCCGCTATCCCGCCGGGGACGAAGTTTGCGCAAGGATCTGCGTAATGGCCACCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAATGTTCCGGTGCGAAGCCCTACGCGAAATGAAAGTGAACGGAGTAAAACTCGGCGCATCATCGACCGATCTGACGTCTCGGATGGATTGAGTAGGAACATCTTGGCCGGACCCCAAAGAAGTGAACTATCTTGGATAGGCAAAACCCGAGGAAACTTTGTGGAGGTTCCCAACGGGTCTTACTGCAAATCGATCGTCACTTA Corollospora_luteola_DQ104809 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTCGGTCGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACCGGGCCCGGCAGTCAGCCGTCCCTCGGGGCGGTGCACTCTGCCGGTCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGCTACGCCCCGCGGGCTGAGGTTCGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGCGGTCCTACATCGAGTGTTCGGGTGCAAAACCCTACGCGGAATGAAAGTGAACGGAGTGAGACCCGGCGCATCATCGACCGATCTGATTTTTCGGATGGATTGAGTAAGACATGTTGGGACCAGCCCGAAAGAAGATGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_maritima_AB361011 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCGGCCGAGTGCCTGGAATGGGACGCCGTAGAGGGTGAGAGCCCCGTACGGCCGGACGTCGAGCCTCTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCGGTCAGCCGTCCCTCGGGGCGGTGCACTCCGCCGGCCAGCCACATCAGCTCGCTGCTGGGGAGAAACGGTGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGCCATGCCCAGCGGGCTGAGGTTCGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCCAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTTTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_maritima_AF491260 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCGGCCGAGTGCCTGGAATGGGACGCCGTAGAGGGTGAGAGCCCCGTACGGCCGGACGTCGAGCCTCTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGG?AATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAG?TAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGTGGTCAGCCGTCCCTCGGGGCGGTGCACTCCGCCGGCCAGCCACATCAGCTCGCTGCTGGGGAGAAACGGTGGGAACGTGGCTCTTCGGAGTGTTATACCCCC?CCATGCCCAGCGGGCTGAGGTTCGCGCAAGGATCT?CGTAATG?CCATCACGA?CCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCCAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTTTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCCAAGCCAGAGGAAACTCTGTGGAGGCTCGCA?CGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_maritima_U46884 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCGGCCGAGTGCCTGGAATGGGACGCCGTAGAGGGTGAGAGCCCCGTACGGCCGGACGTCGAGCCTCTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGG?AATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAG?TAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGTGGTCAGCCGTCCCTCGGGGCGGTGCACTCCGCCGGCCAGCCACATCAGCTCGCTGCTGGGGAGAAACGGTGGGAACGTGGCTCTTCGGAGTGTTATACCCCC?CCATGCCCAGCGGGCTGAGGTTCGCGCAAGGATCT?CGTAATG?CCATCACGA?CCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCCAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTTTCGGATGGATTGAGTAGGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCCAAGCCAGAGGAAACTCTGTGGAGGCTCGCA?CGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_portsaidica_AB361016 TTGTAGTTTGCAGAGGATCTTTGGCAAGGCGCCTTCCGAGTGCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCCTACGGTTGGTGGCCGAGCCTGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTACACCCCTTCTAAAGCTAAATACCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGGGCCCGGTGGTCAGCCGTCCCTCGGGGCGGTGCACTCTGCCGGCTGGCCACATCAGCTTGTGGCGGGGGAGAAACGGTGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGTCATGCCCCGCGGGCTGAGGTTCGCGCAAGGATCTGCGTAATGGCCACCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTCGGGTGCAAAGCCCTACGCGGAATGAAAGTGAACGTAGTGGGACCCGGCGCACCACCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Corollospora_pulchella_AF491274 TTGTAATTTGCAGAGGGTCCTTGGCGAGGCGCCGGCCGAGTGCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTACGGCCGCGCGTCGAGCCTCTGTAAGGCCCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTAAACTCCTTCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTGCACCCAGCGGCTCACCGCCCCCCGGGGCGGTGCACTCCGCTGGCCAGCCACATCGGTTCGAGCCGGGGACAAAGCCGCGGGGACGTGGCTTCTCGGAGTGGTATACCCCCGCTACGCCGCGCGGACCGAAGTCCG?GCAAGGATCTGCCTAATGGCCCCCAAAGAACCCTTTTGAACCCGGACCAAGGATTCGTCTTACATC?AATGTTCGGTGAAAAAGCCCTTCCCGCAATGAAAGTGACCGGAGTAAAACTTGGCGCATCATCGACCGATCTGATTCCTCGGATGGATTGAATAGGACATGCTTGGCCGGACCCCAAAAAAAGTGACTATCTTGGAT?GGCAAAGCCC?AGGAAACTTTGTGGAGGTTCCCAACGGTTTTTACTCAAAATTGATGGCAATTTA Cucullosporella_mangrovei_AY150219 TTGTAATTTGCAGAGGATCTTTGGCGACGCGCCTTCCGAGTTCCTGGAACGGGACGCCTGAGAGGGTGAGAGCCCCGTACGGTCCGGTGCCGAGCCTCTGTAAAGCTCCCTCGATGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATACCCGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTGGGCCCGGCAGTCAGCCGTCCTTCCGGGCGGTGCACTCTGCCGTCCGGCCACATCAGTTTCCGGGAGGGGAGAAACGGCGGGAACGTGGCCCTTCGGGGTGTTATACCCCCGCCATGCCCGGGGGACTGAGGTCCGCGCGAGGATCTGCGTAATGGTCACCACGACCCGTCTTGAAACACGGACCAAGGAGTCATCCTATATCGAGTGTTAGGGCGTCAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATATTGGGCTGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Daldinia_concentrica_U47828 TTG?AATTTGTAGAGGATCTTTGGTTAGGTGCCTTCTGAGTTCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCGAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTCCAGGCGGTCATCCGGTGTTCTCACCGGTGCACTTCGCCTGTTAGCCACATCGGTTCTCTTAGGGGGATAAACCTGGGGAACGTAGCTCCTTGGAGTGTTATACCCTCGTAATACCCGGGGGACCGAGGAACGCGCAAGGATCTGCGTAATGGTCGTCACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTGTCGAGTGTTTGGGTGTTAAACCCCACGCGTAATGAAAGTGAACGGAGTGAGACCTGGTGCATCATCGACCGATCTGATTCTTCGGATGGATTGAGTAAGACATAACTGTTCGGACCCGAAAGATGGTGACTATCGTGGATAGGTGAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Hypoxylon_subgilvum_DQ840068 TTGTAATTTGTAGAGGATCTTTGGTGCGGTACCTTCCGAGTTCCTGGAACGGGACGCCGGAGAGGGTGAGAGCCCCGTACGGTTGGATACCAAGCCTATGTATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTCCAGGCGGTCATCCGGTGTTCTCACCGGTGCACTTCGCCTGTTAGCCACATCGGTTTTCTTAGGGGGACAAATTTAGGGCACGTAGCTCCTTGGAGTGTTATACCCTCGTAATACCCGGGGGACCGAGGACCGCGCAAGGATCTGCGTAATGGTCGTCACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTGTCGAGTGTTTGGGTGTTAAACCCCACGCGTAATGAAAGTGAACGGAGTGAGACCTGGTGCATCATCGACCGATCTGATTCTTCGGATGGATTGAGTAAGACATAACTGTTCGGACCCGAAAGATGGTGACTATCGTGGATAGGTGAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Microascus_trigonosporus_U47835 TTGTAATTTGAAGAGGAT?TTCGGCAAGGTGC?GTCCGAGTTCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGTCGGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTGCGCCCGT?GGTCAGCCGTCGCTCGCGGCGGCGCACTCCGGCGGCCGGCCACATCAGTTCGCCTCGGGGGAGAAAC?GCGGGAATGTGGCTCTACGGAGTGTTATACCCCCGTAATACCGGGCGGACTGAGGACCGCGCAAGGATCTGCGTAATGGTCGTCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTATATCGAGTGTACGGGTGTCAAACCCTCCGCGTAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATATTGGGCCGGACCCGAAAGAAGGTGACTATCCTGTGTAGGTAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCACATG Nais_inornata_AF539476 TTGTAATTTGCAGAGGATCTTCTGCGCGGTGCCTTCCGAGTTCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTCGGTAACTAAGCTATTGTGTAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTGGGCCTGGTAGTCAGCCGTCCTTCTGGGCGGTGCACTCTGCCGGTCAGCCACATCAGTTGCTAGTCGGGGAGAAATAGTGGGAACGTGGCTCTTCGGAGTGTTATACCCCTATTATGCCCCGGCGACTGAGGTTAGCGTACGGATCTGCGTAATGGTCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCATCCTATATCGAGTGTTTGGGTGTTAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATATTGGGCTGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Nemania_diffusa_DQ840076 TTGTAATTTGTAGAGGATCTTTGGCGCGGTGCCTTCCGAGTTCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTCCTAGCGGTCATCCGGTGTTCTCGCCGGTGCACTTCGCTAGTGAGCCACATCGGTTTCTGCAGGGGGATAAACCCAGGGAACGTAGCTCTTTGGAGTGTTATACCCCCATAATACCGCGGGGACCGAGGACCGCGCAAGGATCTGCGTAATGGTCGTCACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTATCGAGTGTTTGGGTGTTAAACCCCACGCGTAATGAAAGTGAACGGAGTGAGACCTGGTGCATCATCGACCGATCTGATTCTTCGGATGGATTGAGTAAGACATAACTGTTCGGACCCGAAAGATGGTGACTATCGTGGATAGGTGAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Neptunella_longirostris_AF539472 TTGTAATTTGCAGAGGATCTTTGGCGACGTGCCTTCCGAGTTCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTCTGGTGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGATCAGACTGGGCTTGGTGGTCAGCCGTCCTTCTGGGCGGTGCATTCTGCCGGTCCGCCACATCAGTTGCCAGCTGGGTACAAATTTTGGGAATGTGGCTCTTCGGAGTGTTATACCCCCGTCATGCCCTAGCGACTGAGGTTAGCGTACGGATCTGCATAATGGGTATTACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTGTATCGAGTGTTTGGGTGCTAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATAGCGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Okeanomyces_cucullatus_AY490787 TTGTAATTTGCAGAGGATCTTCTGCGCGGTGCCTTCCGAGTTCCTGGAACGGGACGCCAAAGAGGGTGAGAGCCCCGTACGGTCGGCAACCAAGCTATTGTGTGGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTGGGCCTGGTAGTCAGCCGTCCTTCTGGGCGGTGCACTCTGCCGGTCAGCCACATCAGTTGTCGGTTGGGGAGAAACGACGGGAATGTGGCTCCTCGGAGTGTTATACCCGCGTTATGCCCCGGCGACTGAGGACTGCGCACGGATCTGCGTAATGGTCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCATCCTGCATCGAGTGTTTGGGTGTTAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATGTCGGGCTGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTA Rosellinia_corticium_DQ840078 TTGTAATTTGTAGAGGATCTTTGGCGCGGTGCCTTCCGAGTTCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCCGCCCCGGCGGTCATCCGGCGTTCTCGCCGGTGCACTCCGCCGGCGAGCCACATCGGTTTCCGCGGGGGGACAAACGGGGGGAACGTAGCTCCCTGGAGTGTTATACCCCCATAATACCGCGGGGACCGAGGACCGCGCAAGGATCTGCGTAATGGTCGTCACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTGTCGAGTGTTTGGGTGTCAAACCCCACGCGTAATGAAGGTGAACGTAGTGAGACCTGGCGCATCATCGACCGATCTGATTCTTCGGATGGATTGAGTAAGACATAACTGTTCGGACCCGAAAGATGGTGACTATCGTGGATAGGTGAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Sagaaromyces_abonnis_AF539469 TTGTAATTTGCAGAGGACCTCTGGCGAGGTGCCTTCCGAGTTCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTACGGTCGGCGTCCGAGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCCAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCAGTCAGCCGTCCTTTCGGGCGGTGCACTCTGCCGGCCAGCCACATCAGCTCCCGGTCGGGGAGAAACGGTGGGAACGTGGCTCCTCGGAGTGTTATACCCCCGCCATGCCCCGGGGACTGAGGTTCGCGCAAGGATCTGCGTAATGGCCACCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTATATCGAGTGTTCGGGTGCCAAACCCTACGCGCAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTATGACATACTGGGCCGGACCCGAAAGAAGGTGACTATCTTGTATAGGTAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATATG Varicosporina_ramulosa_AB361020 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTGCCTGGAACGGGCCGCCGGAGAGGGTGAGAGCCCCGTACGGTAGGACGCCGAGCCGGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCAGTCAGCCGTCCCTCGGGGCGGTGCACTCTGCCGGCCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGCTATGCCCCGCGGGCTGAGGTACGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTAGGGTGCAAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Varicosporina_ramulosa_U44092 TTGTAATTTGCAGAGGATCTTTGGCGAGGCGCCTTCCGAGTGCCTGGAACGGGCCGCCGGAGAGGGTGAGAGCCCCGTACGGTAGGACGCCGAGCCGGTGTAAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGGCCAGACTGCGCCCGGCAGTCAGCCGTCCCTCGGGGCGGTGCACTCTGCCGGCCAGCCACATCAGCTCGTGGCGGGGGAGAAACGGCGGGAACGTGGCTCTTCGGAGTGTTATACCCCCGCTATGCCCCGCGGGCTGAGGTACGCGCAAGGATCTGCGTAATGGCCATCACGACCCGTCTTGAAACACGGACCAAGGAGTCGTCCTACATCGAGTGTTAGGGTGCAAAACCCTACGCGAAATGAAAGTGAACGGAGTGAGACTCGGCGCATCATCGACCGATCTGATTTCTCGGATGGATTGAGTAAGACATGCTGGGCCGGACCCGAAAGAAGGTGACTATCTTGGATAGGCAAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG Xylaria_hypoxylon_U47841 TTGTAATTTGCAGAGGAT?TTTTGCGCGGTGCCTTCCGAGTTCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGACCAGACCTTTC?CAGCGGTCATCCGGTGTTCTCACCGGTGCACTTCGCTGGTGAGCCACATCGGTTTCCGCAGGGGGATAAACCTGGGGAACGTAGCTCCCTGGAGTGTTATACCCTCATAATACCGCGGGGACCGAGGACCGCGCAAGGATCTGCGTAATGGTCGTCACGACCCGTCTTGAAACACGGACCAAGGAGTCGAACATTGTCGAGTATTCGGGTGTCAAACCCTATGCGCAATGAAAGTGAACGGAGTGAGACCTGGTGCATCATCGACCGATCTGATTCTTCGGATGGATTGAGTAAGACATAACTGTTCGGACCCGAAAGATGGTGACTATCGTGGATAGGTGAAGCCAGAGGAAACTCTGTGGAGGCTCGCAGCGGTTCTGACTGCAAATCGATCGTCATCTG ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = LSU_rDNA) = N: 1-696; CODONPOSSET * CodonPositions (CHARACTERS = LSU_rDNA) = N: 1-696; END; BEGIN TREES; TITLE Tb10403; LINK TAXA = Taxa1; TRANSLATE 1 Corollospora_portsaidica_AB361016, 2 Corollospora_luteola_DQ104809, 3 Corollospora_maritima_AF491260, 4 Corollospora_maritima_U46884, 5 Corollospora_maritima_AB361011, 6 Corollospora_pulchella_AF491274, 7 Corollospora_lacera_AF491259, 8 Corollospora_cinnamomea_AB361017, 9 Corollospora_gracilis_AB361019, 10 Corollospora_gracilis_AB361018, 11 Corollospora_anglusa_AB361008, 12 Varicosporina_ramulosa_U44092, 13 Varicosporina_ramulosa_AB361020, 14 Okeanomyces_cucullatus_AY490787, 15 Nais_inornata_AF539476, 16 Aniptodera_chesapeakensis_U46882, 17 Neptunella_longirostris_AF539472, 18 Sagaaromyces_abonnis_AF539469, 19 Cucullosporella_mangrovei_AY150219, 20 Arenariomyces_trifurcatus_AF491277, 21 Microascus_trigonosporus_U47835, 22 Daldinia_concentrica_U47828, 23 Hypoxylon_subgilvum_DQ840068, 24 Xylaria_hypoxylon_U47841, 25 Nemania_diffusa_DQ840076, 26 Rosellinia_corticium_DQ840078; TREE NJ_tree = [&R] (((((((((1,2),(((8,(9,10)),(12,13)),11)),((3,4),5)),(6,7)),18),20),(((14,(15,16)),17),19)),21),(((22,23),(24,25)),26)); END;