#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on October 23, 2020; 22:07 GMT TreeBASE (cc) 1994-2008 Study reference: Ishikawa N., Yokoyama J., & Tsukaya H. 2009. Molecular evidence of reticulate evolution in the subgenus Plantago (Plantaginaceae). American Journal of Botany, 96(9): 1627-1635. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S9999] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=66; TAXLABELS Plantago_alpina_1 Plantago_alpina_2 Plantago_asiatica_I Plantago_asiatica_L Plantago_asiatica_f.yakusimensis_I Plantago_asiatica_f.yakusimensis_L Plantago_australis_F.1 Plantago_australis_F.2 Plantago_australis_M.1 Plantago_australis_M.2 Plantago_camtchatica_K Plantago_cornuti_E Plantago_debilis_Q Plantago_depressa_K Plantago_formosana_I.1 Plantago_formosana_I.2 Plantago_formosana_L Plantago_major_AJ884919_I Plantago_major_I Plantago_major_var.japonica_I Plantago_maritima_1 Plantago_maritima_2 Plantago_maritima_3 Plantago_maritima_4 Plantago_maxima_C.1 Plantago_maxima_C.2 Plantago_media_D.1 Plantago_media_D.2 Plantago_media_D.3 Plantago_media_D.4 Plantago_palmata_B Plantago_palmata_G Plantago_raoulii_N Plantago_raoulii_O Plantago_raoulii_P Plantago_raoulii_Q Plantago_reniformis_B Plantago_rigida_H.1 Plantago_rigida_H.2 Plantago_rigida_H.3 Plantago_rigida_H.4 Plantago_rigida_H.5 Plantago_rugelii_I Plantago_rugelii_L Plantago_spathulata_N.1 Plantago_spathulata_N.2 Plantago_spathulata_O.1 Plantago_spathulata_O.2 Plantago_spathulata_P.1 Plantago_spathulata_P.2 Plantago_spathulata_Q Plantago_stauntoni_Q.1 Plantago_stauntoni_Q.2 Plantago_tenuiflora_A.1 Plantago_tenuiflora_A.2 Plantago_tomentosa_F Plantago_tomentosa_M Plantago_trinitatis_F Plantago_trinitatis_M Plantago_uniglumis_J.1 Plantago_uniglumis_J.2 Plantago_uniglumis_J.3 Plantago_uniglumis_J.4 Plantago_uniglumis_J.5 Plantago_virginica_F Plantago_virginica_M ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M4403] TITLE SUC1; LINK TAXA = Taxa1; DIMENSIONS NCHAR=854; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Plantago_alpina_1 GGGTGGGCTCTTCAGCTGTCGCTATTGACTCCGTATGTACAGATGCTCGGTCTGCCGCACGGGGCCAGCTCGTTCATATGGCTATGCGGACCTGTGTCAGGTCTGTTGGTCCAGCCTCTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCAGGCGCCCTCCTCGTCGCGGTGGCTGTAGTTCTTATTGGCTTCGCGGCGGATATAGGCTACTCTGGTGGTGATGATCTAACTAAAAAGACCAAGCCCAGGGCCGTTGTAGTTTTCGTCGTCGGATTCTGGATTCTTGATGTGGCTAACAATATGTTACAGGTATGTCC-GC----T-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAACTGACACACGCAATGTCGTTTTTCGCCTTCTTCATGGGGGCGGGGAACGTTCTTGGGTATGCGGCAGGTTCATACAGCCAACTATACAAGTTCTTGCCGTTTACCCGAACTGATGCCTGTGATATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATTTGTCTCCTAATGAGCCTCACCTGTGTGGCGATGTCCCTTGTAAAGGAGGGCC---CTGTAAATGCTGTGGATGATGATGGCGACAAGGG---CAGTAGCCTAAGGGTCTTTGTCGAATTATTTGGTGCCTTGAAGAACCTCAGCAGGCCTATGTGGATCCTCATGATGGTCAATGCCCTCAACTGGATAGCATGGTTCCCTTTCTTGTTGTATGACACCGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTGATCAGACGGTCTACGATATGGGTG Plantago_alpina_2 GGGTGGGCTCTTCAGCTGTCGCTATTGACTCCGTATGTACAGATGCTCGGTCTGCCGCACGGGGCCAGCTCGTTCATATGGCTATGCGGACCTGTGTCAGGTCTGTTGGTCCAGCCTCTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCAGGCGCCCTCCTCGTCGCGGTGGCTGTAGTTCTTATTGGCTTCGCGGCGGATATAGGCTACTCTGGTGGTGATGATCTAACTAAAAAGACCAAGCCCAGGGCCGTTGTAGTTTTCGTCGTCGGATTCTGGATTCTTGATGTGGCTAACAATATGTTACAGGTATGTCCGCTATCTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAACTGACACACGCAATGTCGTTTTTCGCCTTCTTCATGGGGGCGGGGAACGTTCTTGGGTATGCGGCAGGTTCATACAGCCTACTATACAAGTTCTTGCCGTTTACCCGAACTGATGCCTGTGATATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATTTGTCTCCTAATGAGCCTCACCTGTGTGGCGATGTCCCTTGTAAAGGAGGGCC---CTGTAAATGCTGTGGATGATGATGGCGACAAGGG---CAGTAGCCTAAGGGTCTTTGTCGAATTATTTGGTGCCTTGAAGAACCTCAGCAGGCCTATGTGGATCCTCATGATGGTCAATGCCCTCAACTGGATTGCATGGTTCCCTTTCTTGTTGTATGACACCGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTGATCAGACGGTCTACGATATGGGTG Plantago_asiatica_I GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTACTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATTGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_asiatica_L GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTACCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCAGCAGCCGTTATTCTTATTGGCTTCGCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGCTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_asiatica_f.yakusimensis_I GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTACTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATTGCATGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_asiatica_f.yakusimensis_L GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTACCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCAGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCAGCAGCCGTTATTCTTATTGGCTTCGCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGCTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_australis_F.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATGTCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTAGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGTGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGAGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTACCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACGTATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACT-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTTTACGATATGGGAG Plantago_australis_F.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATGTCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTAGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGTGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCGCCGCGGATATGGGCCACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTGGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACGTATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACT-CAAGGGATCAGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_australis_M.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTACATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTTGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCAGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCTACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCATTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCA-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATACGGGAG Plantago_australis_M.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTTGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCTGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTCGTTGTAGGATTTTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCTTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCA-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGAT-CGGGAG Plantago_camtchatica_K GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCAGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCTGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_cornuti_E GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGGCCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCAGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTGAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAAGCAGTCAGTGTACGATATGGGAG Plantago_debilis_Q GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCCTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCCGGCGCATGCCTTGTCGCCGCAGCCGTTGTTCTTATTGGGTTCGCCGCCGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCCAGGGCTGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTATGTAA----------ACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---GTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCGCTCAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_depressa_K GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCAGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTTGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCATGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_formosana_I.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGTCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATTGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_formosana_I.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTACTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATTGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_formosana_L GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTACCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCAGCAGCCGTTATTCTTATTGGCTTCGCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGGGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGCTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_major_AJ884919_I GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCTGCAGCTGTTATTCTTATTGGCTTCGCTGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGCAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_major_I GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTTGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGCAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_major_var.japonica_I GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTAATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGCAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_maritima_1 GGGTGGGCTCTTCAGCTGTCGCTATTGACTCCGTATGTACAGATGCTCGGTCTGCCGCACGGGGCCAGCTCGTTCATATGGCTTTGCGGACCTGTATCAGGTCTGTTGGTCCAGCCTCTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCAGGCGCCCTCCTCGTCGCGGTGGCTGTAGTTCTTATTGGCTTCGCGGCGGATATAGGCTACTCTGGTGGTGATGATCTAACTAAAAAGACCAAGCCCAGGGCCGTTGTAGTTTTCGTCGTCGGATTCTGGATTCTTGATGTGGCTAACAATATGTTACAGGTATGTCC----------ACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAACTGACACACGCAATGTCGTTTTTCGCCTTCTTCATGGGGGCGGGGAACGTTCTTGGGTATGCGGCAGGTTCATACAGCCAACTATACAAGTTCTTGCCGTTTACCCGAACTGATGCCTGTGATATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATTTGTCTCCTAATGAGCCTCACCTGTGTGGCGATGTCCCTTGTAAAGGAGGGCC---CTGTAAATGCTGTGGATGATGATGGCGACAAGGG---CAGTAGCCTAAGGGTCTTTGTCGAATTATTTGGTGCCTTGAAAAACCTCAGCAGGCCTATGTGGATCCTCATGATGGTCAATGCCCTCAACTGGATTGCATGGTTCCCTTTCTTGTTGTATGACACCGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTGATCAGACGGTCTACGATATGGGTG Plantago_maritima_2 GGGTGGGCTCTTCAGCTGTCGCTATTGACTCCGTATGTACAGATGCTCGGTCTGCCGCACGGGGCCAGCTCGTTCATATGGCTTTGCGGACCTGTATCAGGTCTGTTGGTCCAGCCTCTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCAGGCGCCCTCCTCGTCGCGGTGGCTGTAGTTCTTATTGGCTTCGCGGCGGATATAGGCTACTCTGGTGGTGATGATCTAACTAAAAAGACAAAGCCCAGGGCCGTTGTAGTTTTCGTTGTCGGATTCTGGATTCTTGATGTGGCTAACAATATGTTACAGGTATGTCCGCTATCTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAACTGACACACGCAATGTCGTTTTTCGCCTTCTTCATGGGGGCGGGGAACGTTCTTGGGTATGCGGCAGGTTCATACAGCCAACTATACAAGTTCTTGCCGTTTACCCGAACTGATGCCTGTGACATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATTTGTCTCCTAATGAGCCTCACCTGTGTGGCGATGTCCCTTGTAAAGGAGGGCC---CTGTAAATGCTGTGGATGATGATGGCGACAAGGG---CAGTAGCCTAAGGGTCTTTGTCGAATTATTTGGTGCCTTGAAGAACCTCAGCAGGCCTATGTGGATACTCATGATGGTCAATGCGCTCAACTGGATAGCATGGTTCCCTTTCTTGTTGTATGACACCGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTGATCAGACGGTCTACGATATGGGTG Plantago_maritima_3 GGGTGGGCTCTTCAGCTGTCGCTATTGACTCCGTATGTACAGATGCTCGGTCTGCCGCACGGGGCCAGCTCGTTCATATGGCTTTGCGGACCTGTATCAGGTCTGTTGGTCCAGCCTCTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCAGGCGCCCTCCTCGTCGCGGTGGCTGTAGTTCTTATTGGCTTCGCGGCGGATATAGGCTACTCTGGTGGTGATGATCTAACTAAAAAGACCAAGCCCAGGGCCGTTGTAGTTTTCGTCGTCGGATTCTGGATTCTTGATGTGGCTAACAATATGTTACAGGTATGTCCGCTATCTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAACTGACACACGCAATGTCGTTTTTCGCCTTCTTCATGGGGGCGGGGAACGTTCTTGGGTATGCGGCAGGTTCATACAGCCAACTATACAAGTTCTTGCCGTTTACCCGAACTGATGCCTGTGATATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATTTGTCTCCTAATGAGCCTCACCTGTGTGGCGATGTCCCTTGTAAAGGAGGGCC---CTGTAAATGCTGTGGATGATGATGGCGACAAGGG---CAGTAGCCTAAGGGTCTTTGTCGAATTATTTGGTGCCTTGAAGAACCTCAGCAGGCCTATGTGGATACTCATGATGGTCAATGCGCTCAACTGGATAGCATGGTTCCCTTTCTTGTTGTATGACACCGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTGATCAGGCGGTCTACGATATGGGTG Plantago_maritima_4 GGGTGGGCTCTTCAGCTTTCGCTATTGACTCCGTATGTACAGATGCTCGGTCTGCCGCACGGGGCCAGCTCGTTCATATGGCTTTGCGGACCTGTATCAGGTCTGTTGGTCCAGCCTCTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCAGGCGCCCTCCTCGTCGCGGTGGCTGTAGTTCTTATTGGCTTCGCGGCGGATATAGGCTACTCTGGTGGTGATGATCTAACTAAAAAGACCAAGCCCAGGGCCGTTGTAGTTTTCGTCGTCGGATTCTGGATTCTTGATGTGGCTAACAATATGTTACAGGTATGTCCGCTATCTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAACTGACACACGCAATGTCGTTTTTCGCCTTCTTCATGGGGGCGGGGAACGTTCTTGGGTATGCGGCAGGTTCATACAGCCAACTATACAAGTTCTTGCCGTTTACCCGAACTGATGCCTGTGATATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATTTGTCTCCTAATGAGCCTCACCTGTGTGGCGATGTCCCTTGTAAAGGAGGGCC---CTGTAAATGCTGTGGATGATGATGGCGACAAGGG---CAGTAGCCTAAGGGTCTTTGTCGAATTATTTGGTGCCTTGAAGAACCTCAGCAGGCCTATGTGGATACTCATGATGGTCAATGCGCTCAACTGGATAGCATGGTTCCCTTTCTTGTTGTATGACACCGACTGGATGGGTAGGGAAGTGTACGGTGGGAAGGTTGATCAGGCGGTCTACGATATGGGTG Plantago_maxima_C.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCTCATGCCTTGTCGCGATAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTTACCT-GACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTTAAGACCTGTTTCCTCATTCACATATGCCTTATCATGTGCCTCACAATCACAGCGTTGTCAATTGTAAAGGAGCCCC---CTGTCAACGTCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTGTATGATATGGGAG Plantago_maxima_C.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCTCATGCCTTGTCGCGATAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CT-----TAACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACAGATGCCTGTGAAATATTCTGTGCAAATCTTAAGACCTGTTTCCTCATTCACATATGCCTTATCATGTGCCTCACAATCACAGCGTTGTCAATTGTAAAGGAGCCCC---CTGTCAACGTCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTGTATGATATGGGAG Plantago_media_D.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGGCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCACATGCCTTGTCGCGGTAGCCGTTGTTCTTATTGGCTTCGCTGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTATGTAC-CTATTTC-TACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACATGCGATGTCGTTTTTCGCCTTCTTCATGGGGGTCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTGTTGCCCTTCACCCGAACGGATGCGTGTGAAATATTCTGTGCAAATCTTAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACAATCACCGCGTTGTCAATTGTAAAGGAGCCCCCCCTTGTCAACGCCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCCTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTGTATGATATGGGAG Plantago_media_D.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGGCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCACATGCCTTGTCGCGGTAGCCGTTGTTCTTATTGGCTTCGCTGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTATGTAC-CTATTTC-TACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGGTCGGCAACGTGCTTGGGTACGCGGCAGGATCATACAACAACCTACACAGGCTGTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTTAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACAATCACCGCGTTGTCAATTGTAAAGGAGCCCCCCCATGTGAACGCCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCCTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTGTATGATATGGGAG Plantago_media_D.3 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGGCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCACATGCCTTGTCGCGGTAGCCGTTGTTCTTATTGGCTTCGCTGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTATGTAC-CTATTTC-TACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTGTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTTAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACAATCACCGCGTTGTCAATTGTAAAGGAACCCCCTGCTGTGAACGCCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCCTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTGTATGATATGGGAG Plantago_media_D.4 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGGCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCACATGCCTTGTCGCGGTAGCCGTTGTTCTTATTGGCTTCGCTGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTATGTAC-CTATTTC-TACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGCTCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTGTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTTAAGACCTGTTTCCTCATTCACATATGCTTCATCATGTGCCTCACAATCACCGCGTTGTCAATTGTAAAGGAGCCCCCCCATGTGAACGCCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCCTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTGTATGATATGGGAG Plantago_palmata_B GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGTGCAAGCCTTGTCGCGGTAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCTCTCGGCTGGTGATGATATGACTAAGAAGACTAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCTATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAAGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACAATCACTGCGTTGTCAATTGTAAAGGAGCCCC---TTGTCAACGTCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATTGCGTGGTTCCCGTTCTTACTGTATGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTATGATATGGGAG Plantago_palmata_G GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTAT-----ACCATGCAGGGCGTTCCTGGCAGATTTATCAACCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCATTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCATGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_raoulii_N GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCAGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAACAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGTTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_raoulii_O GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTATTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGTTTGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_raoulii_P GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGGTTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCGCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACACTT-TTTTCCT-CACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCTTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCATTGTAAAGGAGCCCC---ATGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_raoulii_Q GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCCTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCCGGCGCATGCCTTGTCGACGCAGCCGTTGTTCTTATTGGCTTCGCCGCCGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCCAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTATGTA-----------ACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCAGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCATTGTAAAGGAGCCCC---GTGTCAACGTTGTGGATGATGA--GCT-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCCCTCAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCATTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_reniformis_B GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGTTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGTAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCTACTCGGCTGGTGATGATATGACCAAGAAGACTAAGCCGAGGGCAGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTACGCTATCTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATCACCGCGTTGTCAATTGTAAAGGAGCCCC---TTGTCAACGTCGTGGATGATGA--CCG-CAAGGG---AGGTAGCCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATTGCGTGGTTCCCGTTCTTGCTGTATGATACCGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rigida_H.1 GGTTGGGCTCTTCAGCTTTCTCTCCTGACTCCATATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTTCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGGGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCAGATATAGGATACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTGGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCCTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTTGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTGATGTGCCTGACAATTACCGCATTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCTTAAAGAACCTGAGCAAGCCTATGTGGATCTTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCATTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rigida_H.2 GGTTGGGCTCTTCAGCTTTCTCTCCTGACTCCATATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTTCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGGGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTTGCCGCAGATATAGGATACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTGGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCCTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTTGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTGATGTGCCTCACAATTACCGCATTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCTTGAAGAACCTGAGCAAGCCTATGTGGATCTTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCATTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rigida_H.3 GGGTGGGCTCTTCAGCTTTCTCTCCTGACTCCATATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCATTCATTTGGTTATGTGGACCGGTTTCGGGTCTTCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAAGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGGGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTTGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGACAAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACATGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACATGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCCTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGCTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGGCGAATTGTTCGGTGCCTTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACGGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rigida_H.4 GGGTGGGCTCTTCAGCTTTCTCTCCTTACTCCATATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCATTCATTTGGTTATGTGGACCGGTTTCGGGTCTTCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAAGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGGGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTTGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCAAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTTGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCGAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACTGCCTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGCTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCTTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTATTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rigida_H.5 GGGTGGGCTCTTCAGCTTTCTCTCCTGACTCCATATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCATTCATTTGGTTATGTGGACCGGTTTCGGGTCTTCTGGTTCAGCCTTTGGCAGGATATTTTAGTGATAAGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGGGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTTGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCAAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTTGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCGAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACTGCCTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGCTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCTTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTATTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rugelii_I GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCATATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGACACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCTGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGCTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCAGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGCAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_rugelii_L GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTTGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAACATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGCCAGTGTACGATATGGGAG Plantago_spathulata_N.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCAGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAACAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGTTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_spathulata_N.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCAGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAACAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGTTACGCGGCAGGTTCATACAACAACCTTCACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_spathulata_O.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCCGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_spathulata_O.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCCGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAATCAGTCAGTGTACGATATGGGAG Plantago_spathulata_P.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGGTTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCCCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCCAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTAC--AC-TTTTTTC-CACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCATTGTAAAGGAGCCCC---ATGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCCCTCAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCAGTGTACGATAAGGGAG Plantago_spathulata_P.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGGTTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCGCCGCAGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTAC--AC-TTTTTTC-CACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCATTGTAAAGGAGCCCC---ATGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCCCTCAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCAGTGTACGATAAGGGAG Plantago_spathulata_Q GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCCTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCCGGCGCATGCCTTGTCGCCGCAGCCGTTGTTCTTATTGGCTTCGCCGCCGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCCAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTATGTAA-C--------ACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCATTGTAAAGGAGCCCC---GTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCCCTCAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_stauntoni_Q.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCCTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCCGGCGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCGCCGCCGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCCAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTATGTAT-GTATGT--AACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCAGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTGAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCGTTGTAAAGGAGCCCC---GTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCGCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCGGTGTACGATATGGGAG Plantago_stauntoni_Q.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCCTCCTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCCGGCGCATGCCTTGTCGCGGCAGCCGTTGTTCTTATTGGCTTCGCCGCCGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCCAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTATGTAA-T--ACAC-TACCATGCAGGGCGTTCCTGGCAGATTTATCAGGCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATCATGTGCCTCACTATTACCGCGTTGTCCATTGTAAAGGAGCCCC---GTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTATCGAATTGTTCGGTGCCCTCAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGAAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_tenuiflora_A.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTCGGCCTGCCACACGGGGCGGCCTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCACGGTAGCCGTTATTCTTATTGGCTTCGCGGCGGATATAGGCCATTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCAGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTAGCCAACAATATGTTGCAGGTACGTAA-GTAT-----ACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGAATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAATCTACACACTTTCTTGCCCTTCACCAGAACGGATGCCTGTGAAGTATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCATATCTGCCTCATCTTGAGTCTCACAATTACGGCGTTGTCCATTGTAAAGGAGCCCG---ATGTCAACATTGTGGATGATGA--TCG-CAAGGG---AGGTAGCTTTATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGCTGTATGATACTGACTGGATGGGTAGGGAAGTGTACGGAGGTAAGGTTAACCAGTCGGTGTATGATATGGGTG Plantago_tenuiflora_A.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTCGGCCTGCCACACGGGGCGGCCTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGGTATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCGGCGGATATAGGCCATTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCAGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGATGTAGCCAACAATATGTTACAGGTACGTAC-G-----C-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGAATCGGCAATGTGCTTGGGTATGCGGCAGGTTCATACAACAATCTACACACTTTCTTGCCCTTCACCAGAACGGATGCCTGTCAAACATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCATATTGTGTCTCACAATTACGGCGTTGTCCATTGTAAAGGAGCCTG---TTGTCAACGTTGTGGATGATGA--TCG-CAAGGG---AGGTAGCTTAATGGTTTTTGTCGAATTGTTCAGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATTCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGCTGTATGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCGGTTTATGATATGGGTG Plantago_tomentosa_F GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATGTCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGCTATGTGGACCGGTTTCGGGTCTGCTAGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGTGCATGCCTTGTCGCGGTAGCCGTTGTTCTTATTGGCTTCGCCGCGGATATAGGACACTCGACTGGGGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTGGTGGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGGTCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACGTATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCT-CAAGGG---AGGTAGTCTAATGGTTTTTGTCAAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_tomentosa_M GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTTGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTTGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTCGTTGTAGGATTTTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCATTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCA-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATACGGGAG Plantago_trinitatis_F GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATGTCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTAGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGTGCATGCCTTGTCGCGGTAGCCGTTGTTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGACTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTGGTGGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCATTTTTCGCCTTCTTCATGGGGGTCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACGTATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACT-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_trinitatis_M GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTTGGGAGGCGTCGTCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGACTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTCGTTGTAGGATTTTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCATTTTTCGCCTTTTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCA-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACTTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATACGGGAG Plantago_uniglumis_J.1 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGAGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTTGTGGTTTTTGTTGTAGGATTCTGGATTCTGGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTAT-TACAACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACATAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCATGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_uniglumis_J.2 GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGAGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTAT-TACAACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACATAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_uniglumis_J.3 GGTTGGGCTCTTCAGCTTTCTCTCCTGACTCCGTATATCCAAATGCTTGGCCTTCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCAAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTTGTGGTTTTTGTTGTAGGATTCTGGATTCTGGACGTCGCCAACAATATGTTGCAGGTAAGGAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTGCTGCCCTTCACTCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGTAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_uniglumis_J.4 GGTTGGGCTCTTCAGCTTTCTCTCCTGACTCCGTATATCCAAATGCTTGGCCTTCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTTGTGGTTTTTGTTGTAGGATTCTGGATTCTGGACGTGGCCAACAATATGTTGCAGGTACGGAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCTTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCAC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_uniglumis_J.5 GGTTGGGCTCTTCAGCTTTCTCTCCTGACTCCGTATATCCAAATGCTTGGCCTTCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACGAAGAAGACCAAGCCGAGGGCCGTTGTGGTTTTTGTTGTAGGATTCTGGATTCTGGACGTGGCCAACAATATGTTGCAGGTACGGAC-CTATTTCCGACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCTTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCG-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_virginica_F GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGTCTGCTAGTCCAGCCTTTGGCAGGATATTTTAGTGATAGATGTAAATCCAGATTCGGGAGGCGTCGCCCTTTTATCATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGAGTAAGAAGACCAAGCCGAGGGCCGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTCGCCAACAATATGTTGCAGGTACGTAC-CTATTTC-AACCATGCAGGGCGTTCCTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCGTTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTATGCGGCAGGTTCATACAACAACCTACACAGGCTCTTGCCCTTCACCCGAACGGATGCCTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACAATAACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--ACT-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCACTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCGTGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGTAAGGTTAACCAGTCAGTGTACGATATGGGAG Plantago_virginica_M GGGTGGGCTCTTCAGCTTTCGCTCCTGACTCCGTATATCCAAATGCTTGGCCTGCCACATGGGGCTGCGTCGTTCATTTGGTTATGTGGACCGGTTTCGGGGCTGCTGGTCCAGCCTTTGGCAGGATATTTTAGTGATAGGTGTAAATCCAGATTTGGGAGGCGTCGCCCTTTTATTATGTCGGGCGCATGCCTTGTCGCGGCAGCCGTTATTCTTATTGGCTTCGCCGCGGATATAGGCCACTCGGCTGGTGATGATATGACTAAGAAGACCAAGCCGAGGGCTGTTGTTGTTTTTGTTGTAGGATTCTGGATTCTTGACGTTGCCAACAATATGTTGCAGGTACGTAC-CTATTTA-AACCATGCAGGGCGTTCTTGGCAGATTTATCAGCCGGAGACGAGAAGAAAATGACACACGCGATGTCATTTTTCGCCTTCTTCATGGGGATCGGCAACGTGCTTGGGTACGCGGCAGGTTCATACAACAACCTACACAGGCTCCTGCCCTTCACCCGAACGGATGCTTGTGAAATATTCTGTGCAAATCTCAAGACCTGTTTCCTCATTCACATATGCCTCCTCATGTGCCTCACGATTACCGCGTTGTCCATTGTAAAGGAGCCCC---TTGTCAACGTTGTGGATGATGA--GCA-CAAGGG---AGGTAGTCTAATGGTTTTTGTCGAATTGTTCGGTGCCCTGAAGAACCTGAGCAAGCCTATGTGGATCCTGATGTTGGTCACTTGCCTCAACTGGATCGCATGGTTCCCGTTCTTGTTGTACGATACTGACTGGATGGGTAGGGAAGTGTACGGTGGCAAGGTTAACCAGTCAGTGTACGATACGGGAG ; END; BEGIN CODONS; CODONPOSSET CodonPositions (CHARACTERS = SUC1) = N: 1-854; CODONPOSSET * CodonPositions (CHARACTERS = SUC1) = N: 1-854; END; BEGIN TREES; TITLE Tb10431; LINK TAXA = Taxa1; TRANSLATE 1 Plantago_alpina_2, 2 Plantago_alpina_1, 3 Plantago_maritima_4, 4 Plantago_maritima_1, 5 Plantago_maritima_3, 6 Plantago_maritima_2, 7 Plantago_tenuiflora_A.2, 8 Plantago_tenuiflora_A.1, 9 Plantago_major_I, 10 Plantago_major_AJ884919_I, 11 Plantago_major_var.japonica_I, 12 Plantago_cornuti_E, 13 Plantago_reniformis_B, 14 Plantago_maxima_C.1, 15 Plantago_maxima_C.2, 16 Plantago_asiatica_I, 17 Plantago_asiatica_L, 18 Plantago_asiatica_f.yakusimensis_I, 19 Plantago_asiatica_f.yakusimensis_L, 20 Plantago_rugelii_I, 21 Plantago_rugelii_L, 22 Plantago_palmata_G, 23 Plantago_palmata_B, 24 Plantago_media_D.3, 25 Plantago_media_D.2, 26 Plantago_media_D.4, 27 Plantago_media_D.1, 28 Plantago_formosana_L, 29 Plantago_formosana_I.1, 30 Plantago_formosana_I.2, 31 Plantago_trinitatis_F, 32 Plantago_trinitatis_M, 33 Plantago_virginica_F, 34 Plantago_virginica_M, 35 Plantago_tomentosa_F, 36 Plantago_tomentosa_M, 37 Plantago_australis_M.2, 38 Plantago_australis_F.1, 39 Plantago_australis_M.1, 40 Plantago_australis_F.2, 41 Plantago_debilis_Q, 42 Plantago_depressa_K, 43 Plantago_camtchatica_K, 44 Plantago_stauntoni_Q.1, 45 Plantago_stauntoni_Q.2, 46 Plantago_spathulata_N.2, 47 Plantago_spathulata_P.2, 48 Plantago_spathulata_Q, 49 Plantago_spathulata_O.1, 50 Plantago_spathulata_P.1, 51 Plantago_spathulata_O.2, 52 Plantago_spathulata_N.1, 53 Plantago_raoulii_Q, 54 Plantago_raoulii_O, 55 Plantago_raoulii_N, 56 Plantago_raoulii_P, 57 Plantago_uniglumis_J.3, 58 Plantago_uniglumis_J.4, 59 Plantago_uniglumis_J.5, 60 Plantago_uniglumis_J.2, 61 Plantago_uniglumis_J.1, 62 Plantago_rigida_H.4, 63 Plantago_rigida_H.5, 64 Plantago_rigida_H.1, 65 Plantago_rigida_H.2, 66 Plantago_rigida_H.3; TREE Fig._2 = [&R] ((1,(2,(((3,5),6),4))),((7,8),((((((((9,10,11),((16,18,30),29)),20),(((62,63),66),(64,65))),22),12,((((31,35),40),38),33)),(((17,19,28),(21,((32,36,37),34,39)),((((((41,48,53),45),44),((47,50),56)),((49,51),54)),(46,52,55)),(42,43)),((57,(58,59)),(60,61)))),((13,23),((14,15),(((24,26),25),27)))))); END;