#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 12, 2021; 21:02 GMT TreeBASE (cc) 1994-2008 Study reference: Berger B.A., Lim A., Thompson V., Ricigliano V., & Howarth D.G. 2016. Elaboration of bilateral symmetry across Knautia macedonica capitula related to changes in ventral petal expression of CYCLOIDEA-like genes. EvoDevo, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S18401] [ The following blocks are input data for analysis step 17821 ] BEGIN TAXA; TITLE TaxaForAnalysisStep17821; DIMENSIONS NTAX=165; TAXLABELS Abelia_x_grandiflora_1 Abelia_x_grandiflora_3Aa Abelia_x_grandiflora_3Ab Bassecoia_bretschneideri_1 Bassecoia_bretschneideri_2A Bassecoia_bretschneideri_2Ba Bassecoia_bretschneideri_2Bb Bassecoia_bretschneideri_3B Centranthus_ruber_2A Centranthus_ruber_2Ba Centranthus_ruber_2Bb Centranthus_ruber_3A Centranthus_ruber_3B Cephalaria_hirsuta_1 Cephalaria_hirsuta_1B Cephalaria_hirsuta_2A Cephalaria_hirsuta_2Ba_1 Cephalaria_hirsuta_2Ba_2 Cephalaria_hirsuta_2Bb Cephalaria_humilis_1B Cephalaria_humilis_2A Cephalaria_humilis_2Ba_1 Cephalaria_humilis_2Ba_2 Cephalaria_humilis_2Bb Cryptothladia_chinensis_2Ba Cryptothladia_chinensis_2Bb Cryptothladia_chinensis_3A Cryptothladia_chinensis_3Ba Cryptothladia_chinensis_3Bb Cryptothladia_kokonorica_2A Cryptothladia_kokonorica_2Ba Cryptothladia_kokonorica_2Bb Cryptothladia_kokonorica_3Ba Cryptothladia_kokonorica_3Bb Diervilla_sessilifolia_1 Diervilla_sessilifolia_2A Diervilla_sessilifolia_2B Diervilla_sessilifolia_3A Dipelta_floribunda_1 Dipelta_floribunda_2A Dipelta_floribunda_2B Dipelta_floribunda_3A Dipelta_floribunda_3B Dipsacus_inermis_1 Dipsacus_inermis_2A Dipsacus_inermis_2Ba Dipsacus_pilosus_1 Dipsacus_pilosus_2Ba Dipsacus_pilosus_2Bb Dipsacus_pilosus_3B Fedia_cornucopiae_1 Fedia_cornucopiae_2A Fedia_cornucopiae_2Ba Fedia_cornucopiae_2Bb Fedia_cornucopiae_3A Fedia_cornucopiae_3B Heptacodium_miconioides_1 Heptacodium_miconioides_2B Heptacodium_miconioides_3A Heptacodium_miconioides_3B Knautia_calycina_1 Knautia_calycina_2A Knautia_calycina_2Ba_1 Knautia_calycina_2Ba_2 Knautia_calycina_2Ba_3 Knautia_calycina_2Bb_1 Knautia_calycina_2Bb_2 Knautia_calycina_3Ba Knautia_calycina_3Bb Knautia_macedonica_1 Knautia_macedonica_2A Knautia_macedonica_2Ba Knautia_macedonica_2Bb Knautia_macedonica_3A Knautia_macedonica_3Bb Kolkwitzia_amabilis_1 Kolkwitzia_amabilis_2A Kolkwitzia_amabilis_2B Kolkwitzia_amabilis_3A Kolkwitzia_amabilis_3B Leycesteria_formosa_1a Leycesteria_formosa_2A Leycesteria_sp_1b Linnaea_borealis_1 Linnaea_borealis_3A Lomelosia_crenata_1B Lomelosia_crenata_2A Lomelosia_crenata_2Ba_1 Lomelosia_crenata_2Ba_2 Lomelosia_crenata_2Bb Lonicera_heteroloba_1 Lonicera_heteroloba_2A Lonicera_heteroloba_2B Lonicera_heteroloba_3Aa Lonicera_heteroloba_3Ab Lonicera_reticulata_2A Lonicera_reticulata_3A Lonicera_reticulata_3B Morina_longifolia_2Ba Morina_longifolia_2Bb Morina_longifolia_3Ba Morina_longifolia_3Bb Patrinia_triloba_1 Patrinia_triloba_2A Patrinia_triloba_2B Patrinia_triloba_3B Pseudoscabiosa_limonifolia_2Ba Pseudoscabiosa_limonifolia_2Bb Pseudoscabiosa_limonifolia_3B Pterocephalus_strictus_1Ba Pterocephalus_strictus_1Bb Pterocephalus_strictus_2A Pterocephalus_strictus_2Ba_1 Pterocephalus_strictus_2Ba_2 Pterocephalus_strictus_2Ba_3 Pterocephalus_strictus_2Bb_1 Pterocephalus_strictus_2Bb_2 Pterocephalus_strictus_3A Pterocephalus_strictus_3B Pycnocomon_rutifolium_1B Pycnocomon_rutifolium_2A Pycnocomon_rutifolium_2Ba Pycnocomon_rutifolium_2Bb_1 Pycnocomon_rutifolium_2Bb_2 Pycnocomon_rutifolium_3A Scabiosa_angustiloba_1Ba Scabiosa_angustiloba_1Bb Scabiosa_angustiloba_2A Scabiosa_angustiloba_2Ba Scabiosa_angustiloba_2Bb Scabiosa_angustiloba_3A Scabiosa_columbaria_1 Sixalix_atropurpurea_1Ba Sixalix_atropurpurea_1Bb Sixalix_atropurpurea_1Bc Sixalix_atropurpurea_1Bd Sixalix_atropurpurea_2A Sixalix_atropurpurea_2Ba_1 Sixalix_atropurpurea_2Ba_2 Sixalix_atropurpurea_2Ba_3 Sixalix_atropurpurea_2Ba_4 Sixalix_atropurpurea_2Bb Sixalix_atropurpurea_3A Sixalix_atropurpurea_3B Sixalix_farinosa_2Ba Sixalix_farinosa_2Bb Symphoricarpos_occidentalis_1 Symphoricarpos_occidentalis_3A Symphoricarpos_occidentalis_3B Symphoricarpos_orbiculatus_1 Symphoricarpos_orbiculatus_2A Triosteum_himalayanum_1 Triosteum_himalayanum_2A Triosteum_himalayanum_2B Triosteum_himalayanum_3A Triplostegia_glandulifera_1 Triplostegia_glandulifera_2B Triplostegia_glandulifera_3B Valerianella_dentata_1 Valerianella_dentata_2B Valerianella_dentata_3B Weigela_hortensis_1 Weigela_hortensis_2A Weigela_hortensis_2B Weigela_hortensis_3A ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M33913] TITLE Caprifoliaceae_CYC_Alignment; LINK TAXA = TaxaForAnalysisStep17821; DIMENSIONS NCHAR=546; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=- GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Abelia_x_grandiflora_1 AAAGACCGCCACAGCAAGATCAATACGGCCCACGGCCCTAGGGACCGGAGAATGAGACTTTCTCTTGAAGTTGCACGAAAGTTCTTCGGTCTCCAGGACAATCTCGGCTTCGATAAGGCCAGCAAAACCGTCGAGTGGTTACTCACTCAATCGAAATCCGCCATCGAGGACCTCACTAGAGCCATCAAAGGC------CTTAACTCG---AACCATAGCTCGAGTGTG---GGTGCC---------------AATAGCACGTCTTCCACT---TCCGAGTGCGAGGTC---------TTGTCTGGTACCGAT---GAGCTG---AGGGGTCAGTTGGCTAAG---------------------------------GCTAAAGGGAAA---------------GGATCGGGTTCG---------AAGGAT---AAAAAG---AGAAAGGCG---------ATAGTT---AGGAGA---GTTGCATTTGACTCTACCGCAAGGGAG{AT}CGAGGGCGAAGGCGAGGGCGAG------------------- Abelia_x_grandiflora_3Aa AAAGATCGCCACAGCAAAATATACACCGCACAAGGCTTGAGGGACCGAAGGATGAGATTGTCCCTTCAAATAGCGCGCAAGTTCTTTGATCTCCAAGATATGTTAGGGTTTGATAAAGCGAGCAAAACCATTGAGTGGCTGTTCACCAAGTCGAAGAAGTCGATTAAAGAA---GTAACCCTAAAACACCCACAGATGAAG------------AACAATTTCCGCAATAGAGAGGAG---------------AAGAACGAGTCAATCACG---TCCGAATGTGAAGTG---------GAATCCCCGATCGCAAACGTT---TAT---------------------------GGTGAAAAG------------------------------------------------------------------------GGAAAAGCTCAA------------------------------------------------------AAGGAGTCGAGGGCGAAAGCGAGGGCGA-------------------- Abelia_x_grandiflora_3Ab AAAGATCGCCACAGCAAAATATACACCGCACAAGGCTTGAGGGACCGAAGGATGAGATTGTCCCTTCAAATAGCACGCAAGTTCTTTGATCTCCAAGATATGTTAGGGTTTGATAAAGCGAGCAAAACCATCGAGTGGCTATTCACCAAGTCAAAGAAGGCGATTAAAGAA---GTAACCCTAAAACACCCACAGATGAAG------------AACAATTTCCGCAATAGAGAGGAG---------------AAGAACGAGTCAATCACG---TCCGAATGTGAAGTG---------GAATCCCCAATCGCGAACGTT---TAT---------------------------GGTGAAAAG------------------------------------------------------------------------GGAAAAGCACAA------------------------------------------------------AAGGAGTCGAGGGCGAAAGCGAG{AG}GCGA-------------------- Bassecoia_bretschneideri_1 ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}AATCTCCA{AG}GACATTCTCGGCTTCGAAAAGGCCAGCAAAACCGTCGAGTGGTTACTCACTCAATCAAAATCCACCATCGAGGACCTCACTAGAGCCATAAGAGGC------CTTAACTCG---AACCATAGCTCAAGTGTG---GGTGCA------------GCCAATAGCGTGTCTTCTACTACTTCCGAGTGTGAGGTC---------TTGTCTGGTACAGAT---GAGCCG---AGGTTTCAGTTGGCTAAG---------------------------------CCTAAAGGAAAAGGATCGAGTGGTGCG---------------------AAGGGT---AAGAAG---AGAAAGGGG---------ATAGTT---AGAAGA---GTTGCATTTGACTCTACCGCTAAGGAG------------------------------------------ Bassecoia_bretschneideri_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTTCAAGATACATTAGGGTTTGACAAAGCAAGTCAAACACTAGACTGGCTACTCAACAAGTCTAAATCAGCTATCAAAGATTTGGTCCGGTCCAAGCTTGGT------TGT---AGTAGTATTACTAGTAGTAGTAACATCGCGAAATGTCGCACTTTGACTTCAATT---------------TACGAAAGCGATGACGAT---GTTGATCCTCGCGAGACGCATAATGTC------GACATTGAG---------------------------------------GAGGATGGG---------------AAAATGATT------------ACTGAGAAA---AAAAACTTG---AGATCAAAGCAAAAGGCC------GAAAAA---TCGGCACTTGATCTTGCGGTTAAAGAATCTAGGGCTAAAGCTCGAGCTCGAGCAAGA------------ Bassecoia_bretschneideri_2Ba ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTAGATTGGCTTTTGACTTGCTCTAAGGACTCAATTGGTAAGCTGATCAACATGAAGATGACT------CAATGCATTAATACT---AATGCTAAT------------------TATACCAATGGATGCTTGTATGAATTGGTG------------------------TATCCTAACAGTAATAGTACT---------------------------------------------------AATATTAATAATAATAGTTCGGGTTGTGAGAAGATTTGT------------------------------------------------------------AGAGATGCA------TTCGATTTGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Bassecoia_bretschneideri_2Bb ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGTTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCTAAGGACTCAATTAGAGAGTTGGTTAATATGAAGATGAAT------AAATGCATTAATACTAATAATCCTAATACTAATCCTAGTCCTAATTATCCCACTGGCTGCTTGTATGAAAAGGTG------------------------TATAATACTAATCCTAGT---------------------------------------------------------------------------------GACAAGATTAGT------------------------------------------------------------AGGAATGCA------TTCGATACAAGTTCTCGAGAGTCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Bassecoia_bretschneideri_3B ------------------------------------------------------------------------GC{GT}CG{CT}A{AG}ATT{CT}TT{CT}GATCTACAAGACATGTTAGGCTTCGACAAAGCTAGCAAAACCATTGAGTGGCTTTTGGCAAAATCAAAAGGGGCAATC{AT}AGGAA---CTCACCGCA------AACATACCA------------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGCATCGTCAAC---------GGAGAAGGAGGTTGTGGG------TTCTTTTCTGGTTCGTCCGAGGGCAGTAAGAACAAAAGG------------------------------GACATG------GCA---ATGACAATGAAGTCGTCCCGGGCGAAGGCAAGAGAAAGAGCAAGA------------ Centranthus_ruber_2A ------------------------------------------------------------------------------------------------GATACTCTAGGGTTTGATAAAGCAAGTCAAACCCTTGATTGGCTACTAAATAAATCC{AG}AATCTGCTATAAAAGATTTGGTGCAATCTAAGCTTGGA------TGTAGT---ACA---------------AATGTTAAA------ACTAGTTTGAGTTCTATT---------------TACATGAACGATGACGACAATGTCGATCTGTCG------------GTGATT---GATGAGCTT---------------------------------------GAAAAGATT---------------AGT------------------TGTAAGGAG---AAGAAGTTG---AGATCAAAGCAA---------------------AGTGC{AG}GCTGATCTTGCAGTTAAGGAATCTAGGGC{AG}AA{AG}GC{AG}AGAGAAAGAGCAA-------------- Centranthus_ruber_2Ba ------------------------------------------------------------------------------------------------GATATGTTGGGGTTTGATAAAGCAAGCAAAACCCTTGATTGGCTGTTGAACAGCTCTAAAGAATCTATAAAAGAGCTGGTGAACATGAAGATGAAG---TTAAAT------------------AGTAGTAAT------------------GGAAGTGGATGTTTGTTTGAAATGGTG---------------------TATAATACAAACAATAATAAT---------------------------------------------------------------------------------GAGAAGATGATG------------------------------------------------------------AGAAATGCA------TTTAATTTGAGCTCAAGAGAATCTAGGGCAAAAGCAAG{AG}GAAAGAGCAA-------------- Centranthus_ruber_2Bb ------------------------------------------------------------------------------------------------GATATGTTGGGTTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTGACAAACTCAAAAGAATCTATTAAGGAGCTTGTGAACAAGAAGATGAAG---GAGATT------------------AACAGTAATAAT---------------GGTAGTGGATGTTTGTTTGAGATGGTG---------------------TATAATAATAATACAAGTAATAAT------------------------------------------------------------------------------GAGAAGATGATG------------------------------------------------------------AGGGATGCA------TTTGATTTGAGTTCAAGAGAATCTAGGGCGAAGGCAAGAGAAAGAGCAA-------------- Centranthus_ruber_3A AAAGATCGGCACAGCAAGATATACACTGCACAAGGATTGAGGGACCGAAGGATGAGATTATCCGTTCAAATTGCGCGCAAATTCTTTGATCTCCAAGATATGTTGGGGTTTGATAAAGCAAGCAAAACCATCGACTGGCTATTCACCAAGTCAAAGAAAGCAATCAAAGAA---GTAACCCTAAAACATTCACAAATGAAG------------AATAGCTTCCGTTACAGAGACGAG------------------------GGGATTACA---TCTGCACGTGATGTG---------GAATCTATGATGGAGAATGTT---TAT---------------------------GTTGAAACA------------------------------------------------------------------------GAAAAATGTGAG------------------------AAGATTGTC------TATGATCCGGTAGCAAGAGAGATGAGAGACCGGGCGAA{AG}GCAAG{AG}GAAAGAGCAA-------- Centranthus_ruber_3B ------------------------------------------------------------------------------------------------GACATGTTAGGCTATGACAAACCTAGCAAAACAATTGAGTGGCTATTGTCCAAATCC{AG}AAGGGGCAATTAGGGAA---ATCAATAAA------AATATACCC------------------------------------------------------------------------------------------------------------------------------------------------------------AGTAGCAGTAGG------------GGTGGAAAAGGGTAT------------------GATTCTTCGGATTCATTAGAA---------------------------------------GGTCAT------GGA---AAGAAAAAGAAGGAACTGAGGGCAAAAGCAAGGGAAAGAGCAA-------------- Cephalaria_hirsuta_1 ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATTCTGGGATTCGAAAAGGCTAGCAAAACTGTTGACTGGCTACTAAGTCAATCAAGATCTGCGATTGAGGACCTCGCTAGAGCA---------------CATAACTCG---------------AGTATT---GGTGCA------------GCTAATAGCACATCGTCTGCT---TCCGAGTGTGAGGTG---------TTATCTGGTACTGATCATGAGCCG---AAGCTTAAGTTGGGTAAA---GGTCAAGAAGATGGGAAAAGTGCGGGTACAGCCAAGGATAAGGTGAAGGTCGCC---GAT------------------AAGAAG---AAGAAG---AGAAAGGGA---------ATAGTT---ACTAGG---GTTGCATTTGACTCTACTGCCCGGGAGTC{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_hirsuta_1B ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCGAGCAAAACGGTTGATTGGTTACTCGATCAATCAAGATCTGC{AC}ATTGAAGATCTCAATAAATTAGCT------------ATTAGTTCG---AACCACATCTCAAGTGTAGAAGATGCAGCTAAGCAGTTAACTAGAACAACATCATCGGCT---TCCGAGTGTGAAGTT---------TTGTCGGGTACTGATCATGAGCCA---AGACCTGAGTTGGCC------------------------------------GGTAAGGGTAAAGGAATAATTTTG---GATGCAGGTATAATC------AAGGAT---AAGAAG---AGAAAGGGA---------AAAGTT---AGAAGG---GTTGCATTTGACTCTAATGCTAGGGAGTT{AG}A{AG}{AG}GC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_hirsuta_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGACAAGGCGAGTCAAACACT-GACTGGCTACTCAACAAGTCCAAA-CCGCCATCAAAGATTTGGTCCGGTCCAAGCT-GG-------TGT---ACTAGTACT---AGTAGTAGTAATATCGACA-GTGCCGTAC-TTGACGTCAATT---------------TACGAGAG{CT}GATGACGAT---GTGGATCCTC-CGAAACGCACAATGTC------GACCTTGAG---------------------------------------GAGGATGGC---------------AAA------------------------------------------------------------------------------------------------------------------------------------------------ Cephalaria_hirsuta_2Ba_1 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATTTGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTT{CT}ACTTGCTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAGT---GCTCAATGCATT------------------------------------------------------------------------------------------AAT{AG}GTGATTGTAAT------AAGGTTGCT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCT{AC}GAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_hirsuta_2Ba_2 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CA{AG}GATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTCATCAACATGAAGAAGATG---ACTACTGTTAAT------------------------------------------------------------------------------TGTGAT---GGTAATAGTATTAATGATAAAGATAAGGTTGCT---------------------------------------------------------------------CAGAAGATTTTTAGG---------------------------------------------------------GGTACTGGA------TTCGA{CT}TCCACTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_hirsuta_2Bb ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CA{AG}GATTTGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACCAGCTC-AAGGACTC{AT}ATTAG{AG}GAGTTGGTTAATATGAAGATGAAGATGGCTAAATGCATTAATACTAATTTTACTAATACTAATACTAATCTT---AATCCTACTGGTTG{CT}TTGTATGAAATGGTG---------------------TATAATACTAATGATAATGAT---AGTGTAATA------------------------------------------------------GTTGGT---------AAGAATATTAGT------------------------------------------------------------AGGGATGCA------TTTCAGATGAGTT{CG}T{AC}GAGA{AG}TCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_humilis_1B ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GA{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCAAGCAAAACTGTTGATTGGTTACTTGATAAATCAAGATCTGCCATTGAGGATCTCACTAAATTAGCC------------CTTAATTCG---AACCACAGCTCGAGTGTA---------------------GCTAGAACAACATCTTCAGCT---TCTGAGTGTGAAGTT---------TTGTCTGGTATTGATCATGAGGCA---AAGGCTGAGCTG---------------------------------------GGTAAGGGTAAAGGGAAAAATTTG---GGTGTGGGCGCAGGC------AAAGAT---AAGAAG---AGAAAGGGA---------ATGGTT---ACAAGG---GTTGCATCTGACTCTAATGCAAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_humilis_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGACAAGGCGAGTCAAACACT-GACTGGCTACTCAACAAGTCCAAA-CCGCCATCAAAGATTTGGTC--GTCCAAGCT-GG-------TGT---ACTAGTACT---AGTAGTAGTAATATCGACAAGTGCCGTACTTTGACGTCAATT---------------TACGAGAG{CT}GATGACGAT---GTGGATCCTC-CGAAACGCACAATGTC------GACCTTGAG---------------------------------------GAGGATGGC---------------AAA------------------------------------------------------------------------------------------------------------------------------------------------ Cephalaria_humilis_2Ba_1 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAA{CT}GAGCTGATCAATATGAAGATGAGT---ACTCAGTGTATT---------------------------------------------------------------------------------------AATAGT---AAAAATAATAAT---AAAATTGCT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Cephalaria_humilis_2Ba_2 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATTTGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAGT---GCTCAATGCATT------------------------------------------------------------------------------------------AATAGTGATTGTAAT------AAGGTTG{AC}T---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCTCGAGAATCT--------------------------------------- Cephalaria_humilis_2Bb ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGACAAAGCAAGCAAAACCCTTGATTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATCTATT---AATAATATTAAT---ACTAATACTTAT------AATCCCACTGGATGCTTGTATGAAATGGTG---------------------TATAATACTAATAATAATTAT---AATAATGGT------------------------------------------------------------------ATTGAAAAAATTAGT------------------------------------------------------------AGAGATGCA------TTTGGTATAAGTTCTAAAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Cryptothladia_chinensis_2Ba ------------------------------------------------------------------------------------------------GACCTGTTAGGTTTTGACAAGGCAAGCAAAACCCTTGACTGGCTGTTGACCAACTCCAAGGACTCCATTAAAGAGCTGGTCCGAGTGAAGAAGACC---CAATGC---AATTCCTTTGATAATAATAGTAAT---------------AAAGGCACCGGATGTCTGTTTGAAATGGTT---------------------TATAATAATAATAATAATAATAAT---------------------------------------------------GGCGGAGTTGTTGGAAAT------GTTGAGAAGATT---------------------------------------------------------------AGAGATGCA------TTTGATTTGAGTTCGAGAGAGTCGAGGGCGAAAGCAAGGGAAAGAGCAA-------------- Cryptothladia_chinensis_2Bb ------------------------------------------------------------------------------------------------GACATGTTAGGTTTTGACAAAGCAAGCAAAACCCTTGACTGGCTGTTGACCAACTCCAAGGACTCCATTCAAGAGCTGGTCCATATGAAGACGACC---TTGGAT---AATAATAATAATAATAATAATAATAAT------------AAAGGGTCGGGATGTCTATTTGAAATGGTT---------------------TATAATAATAATAATAATAACAATAATAAT------------------------------------GATGATGATGGAGGAGTCGTT------------GTTGAGAAGATG---------------------------------------------------------------AGGGATGCA------TTTGATATGAGTCCTAGAGAGTCGAGGGCAAAAGCGAGAGAAAGAGCAA-------------- Cryptothladia_chinensis_3A AAAGATCGGCACAGCAAAATCTACACCGCACAAGGGTTGAGGGACCGTAGGATGAGATTGTCTCTTCAAATAGCGCGTAAGTTCTTTGATCTTCAAGACATTTTAGGGTTTGATAAAGCGAGCAAGACCATCGAGTGGCTATTCACCAAGTCGAAGAAGGCGATCAAAGAA---GTGACCCTAAAACACCCTCATTTGAAG------------AACAATTTATGTAATAGAGTGGAA---------------AAGGACGATTCAATCACG---TCTGAAGGTGAAGTT---------GAATCCGTGATCGAGGATGTT---TAT---------------------------GGAGAAAAG------------------------------------------------------------------------GGAAAAGCTCAA------------------------AAAATAGTT------TATGATCCGGTAGCAAGAGAGACGAGGGCGAAAGCGAG------------------------- Cryptothladia_chinensis_3Ba AAAGACCGACACAGCAAGATCTGTACAGCTCAGGGAGTGAGAGCTAGGAGGATGAGGTTACCCCTTAAAATAGCTCGAAAGTTCTTCCATCTGCAAGACATGTTAGGGTTTGACAAAGCCAGCAAAACGATCGAGTGGATGCTGGCCAAATCAAAAGGGGCCATCAAGGAA---CTCACAGAAAAA---CCCATACCA------------------------------------------------------------------------------------------------------------------------------------------ATTACCACG---------------AATATTGGGGATCAGGGC------------------------ATTTCAGAATATTTGTCAGAAGGCGAAAGGAACAAAATG------------------------------GAATTG------GGA---AAGGCGGCGAGGGAGTCAAGGGCGAA{AG}GCAAGAGAAAGAGCAA-------------- Cryptothladia_chinensis_3Bb AAAGACCGCCACAGCAAAATCTAC--AGCTCAGGGGGTGAGAGCTAGGAGGATGAGGTTACCCCTTAAAATAGCTCGAAAGTTCTTCGATCTGCAAGACATGTTAGGGTTTGACAAAGCGAGCAAAACAATAGAGTGGCTTTTCGCCAAATCAAAAGGAGCCATCAAGGAA---CTCACAAAA------ACCATACCA---------------------------------------------------------------------------------------------------------------------------------------GTTATCACA------------------AATATTGGGGATCAAGGC------------------------ATCTCAGAATATTCGTCAGAAGGTGAAAGGAACAAAAGA------------------------------GAATTG------GGAACTAAGGCGGCAAGGGAGTCAAGGGACAAGGCTAGGGCGAA{AG}GCAAGGGAAAGAGCAA-- Cryptothladia_kokonorica_2A ------------------------------------------------------------------------------------------------GACACGTTGGGATTCGACAAGGCGAGCCAAACACTTGACTGGCTACTCAACAAGTCGAAAATCGCTATAAAAGATTTGGTACAGTCGAAGCTCGGA------TGT---ACCAGC------------------------------AGTGCTTTGATTTCCATT---------------TACGAGGATAGTGAAGATTATCACAATGTCATGGTTCCCCCGGAGAATATC---GATCACCTCGAG------------------------------------GAGGAGGATGAGGAGGAAGGGAATAAAATT---------------GTTAAAGATCAGAAAAAGTCT---AAA---AAGTTA---ACC------------------GCGCTTAATCTTGCTACTAAAGAATCTAGGGCAAAAGCGAGAGAAAGAGCAA-------------- Cryptothladia_kokonorica_2Ba ------------------------------------------------------------------------------------------------GACCTGTTAGGTTTTGACAAGGCAAGCAAAACCCTTGACTGGCTGTTGACCAACTCCAAGGACTTCATTAAAGAGCTGGTCCGAGTGAAGAAGACC---CAATGC---AATTCCTTTGATAATAATAGTAAT---------------AAAGGCACCGGATGTCTGTTTGAAATGGTT---------------------TATAATAATAATAGTAATAATAATAATAATAATAAT---------------------------------------GG{CG}GGAGT{AT}GTTGGAAAT------GTTGAGAAGATT---------------------------------------------------------------AGAGATGCA------TTTGAT{AT}TGAGTTCGAGAGAGTCGAGGGC{AG}AAAGCGAGAGAAAGAGCAA-------------- Cryptothladia_kokonorica_2Bb ------------------------------------------------------------------------------------------------GACATGTTAGGTTTTGACAAAGCAAGCAAAACCCTTGACTGGCTGTTGACCAACTCCAAGGACTCCATTCAAGAGCTGGTCCATATGAAGACGACC---TTGGAT---AAT---AATAATAATAATAATAATAAT------------AAAGGGTCGGGATGTCTATTTGAAATGGTT---------------------TATAATAATAATAATAATAACAATAATAAT------------------------------------GATGATGATGGAGGAGTCGTT------------GTTGAGAAGATG---------------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCTAGAGAGTCGAGGGCGAAAGCGAGGGAAAGAGCAA-------------- Cryptothladia_kokonorica_3Ba ------------------------ACAGCTCAGGGAGTGAGAGCTAGGAGGATGAGGTTACCCCTTAAAATAGCTCGAAAGTTCTTCCATCTGCAAGACATGTTAGGGTTTGACAAAGCCAGCAAAACGATCGAGTGGATGCTGGCCAAATCAAAAGGGGCCATCAAGGAA---CTCACAGAAAAA---CCCATACCA------------------------------------------------------------------------------------------------------------------------------------------ATTACCACG---------------AATATTGGGGATCAGGGC------------------------ATTTCAGAATATTTGTCAGAAGGCGAAAGGAACAAAATG------------------------------GAATTG------GGA---AAGGCGGCGAGGGAG------------------------------------------ Cryptothladia_kokonorica_3Bb ------------------------------------------------------------------------------------------------GACATGTTAGGGTTTGACAAAGCGAGCAAAACAATAGAGTGGCTTTTCGCCAAATCAAAAGGAGCCATCAAGGAA---CTCACAAAA------ACCATACCA---------------------------------------------------------------------------------------------------------------------------------------GTTATCACA------------------AATATTGGGGATCAAGGC------------------------ATCTCAGAATATTCGTCAGAAGGTGAAAGGAACAAAAGA------------------------------GAATTG------GGAACTAAGGCGGCAAGGGAG------------------------------------------ Diervilla_sessilifolia_1 AAAGATCGGCACAGCAAGATCAACACCGCACACGGCCCTAGGGACCGCAGAATGAGGCTCTCCCTCGATGTGGCACGCAAGTTCTTTGGCCTCCAAGACATGCTTTGCTTCGACAAGGCAAGCAAGACGGTCGAGTGGTTGCTAACAAAGTCAAAATCCGCCATCAAGGACCTCACTAGAGGAGGCGGAGGA------CTTAACTCC---AACCATAGCTCCAGTGTGGGTGGTGCC---------------AATAGCGCATCTTCCACT---TGCGAGTGCGAGGTCGAG---GTCTTGTCTGGGATTGAG---GAGCCAGGTGGT---GTC---GACGAAAACGATCACACACGC---------------------AAGGGGAAA---------------GGCTCGGGCGCC---------AAGGAA---AAGAAG---AGTAAGGGG---------------GCTAGGAGG---ATTGCATTTGATCCGATCACGAGGGAGTCGAGGGCGAAAGCGA-------------------------- Diervilla_sessilifolia_2A AAAGATCGCCACAGCAAAATATACACGGCCCAAGGACCCCGAGACCGGAGGGTAAGATTGTCCATTGAAATCGCACGGAAGTTCTTTGATCTTCAAGACATGCTAGGGTTCGACAAGGCGAGTAGAACACTCGACTGGCTCCTCAACAAGTCGAAAACCGCCATCAAAGATTTAGTCCAGTCGAAGCTCGGC------TGC---ACT------------------------------AGTACTGCCTTGACTTCTATT---------------TACGAGTGCGAAGAAATG------AAGTCA---AAGACCTACAAG------------TTAGTCCCC------------------------------------AATAATGGGGAA---------------------ATCGCGTGTGGGATTAAAGAA---AAAAAGATGAGGAAGCAG---------ACA------GATAAA---TCTGCCATTGATCTTGTTGCTAGAGAGTCGAGGGCGAAAGCGAGGGCGAG------------------- Diervilla_sessilifolia_2B AAAGATCGCCACAGCAAAATATACACGGCACACGGTCCTAGGGATCGGAGAGTAAGGTTATCAATGGAGATAGCTCGGAAATTCTTCGACCTCCAAGACCTGCTAGGTTTTGACAAAGCAAGTAAAACCCTTGACTGGCTGCTGACCAACTCGAAGGCCGCGATTAAAGAGTTGGTCCAGATGAAGATCAGC------TGC---ACTACT------GGCTCTCAA------------------------------------TGCGATACGGTATGTGAA------------AATTACAATTACAATTATAATAATAATAAT---------GAGATG---------------------------------------CCTGTTGGA---------AACGAGAAGATC---------------------------------------------------------------AGGGATGCA------TTTGATAGTAGTTCGAGAGAGTCGAGGGCGAAAGCGAGAGCGA-------------------- Diervilla_sessilifolia_3A AAAGATCGGCACAGCAAAATCTACACCGCGCAAGGCCTGAGGGACCGGAGGATGAGATTATCGGTTCAAATTGCTCGCAAGTTCTTTGATCTACAAGACATGTTAGGGTTTGATAAAGCAAGCAAAACCATCGAGTGGCTATTCACCAAGTCGAAGAAGGCGATCAAGGAA---ATAACCCTAAACCACCAACAAATGAAG------------AACAGTTACCGCAGT---AGAGAG---------------AAGAGCGAGTCCTTTGTG---TCAGAACGTGAACTA---------GAATTCGTAACCGAGAATGTT---AAT---------------------------GATGAAAGG------------------------------------------------------------------------GGAAAAGCTCAA------------------------AAAGTAGCA------AATGATCCACTAGCACGAGAGTCGAGGGCGAAAGCGAGAGCGAG------------------- Dipelta_floribunda_1 AAAGACCGGCACAGCAAGATCAACACGGCCCACGGCCCTAGGGACCGGAGAATGAGACTCTCTCTTGATGTTGCACGAAAGTTCTTCGGTCTCCAAGACATTCTTGGCTTCGACAAGGCCAGCAAAACCGTCGAGTGGTTACTCACTCAATCGAAATCCGCCATCAAGGACCTCACTAGAGCCACCAAAGGC------CTTAACTCA---AACCATAGCTCGAGTGTG---GGTGCC---------------AATAGCACGTCTTCCACT---TCCGAGTGCGAGGTC---------TTGTCTGGTACCGAT---GAGCCG---AGGGGTCAGTTGGCTAAG---------------------------------GCTAAAGGGAAA---------------GGATCGGGTTCG---------AAGGAC---AAAAAG---AGAAAGGCG---------ATAGTT---AGGAGA---GTTGCATTTGACTCTACGGCAAGGGAGTCGAGGGCGAAAGCGAGGGCGAG------------------- Dipelta_floribunda_2A ------------------------------------------------------------------------------------------------GACACGTTGGGATTCGACAAGGCGAGCCAAACACTCGACTGGCTACTCAACAAGTCCAAAGCCGCCATCAAAGATTTAGTCCACTCGAAGCTCGGC------TGT------ACC------AGCAGTAGC---ATTGCAAAC---TGTACTTTGAGTTCCATT---------------TACGAGAGTGATGATGATGACGTGGCTCCCTCAGAAACCCACAATATTATA---GACCTCGAG---------------------------------------GAGGACGGG---------------AAAATG---------------GTTAAAGAG---AAAAAGTCG---AGA---AAGCAA---ACG------GATAAA---TCCGCAATTGATCTTGCAGCTAAAGAGTCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAA-------------- Dipelta_floribunda_2B ------------------------------------------------------------------------------------------------GACATGCTAGGTTTTGACAAAGCAAGCAAAACCCTTGACTGGCTTTTGAACAACTCGAAGGACTCCATTAAAGAGCTGGTCCATATGAAGACGAAG------ATC---AGTACTCATAAT---------------ACTACGGGA---------------TGTCTGTTCGAAATGGTG---------------------TATAATAATAATGGT---------------------------------------------------------------------GTTGGG---------AATGAGAAGATT---------------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCGAGAGAGTCTAGGGCAAAGGC{AG}AGAGAAAGAGCAA-------------- Dipelta_floribunda_3A AAAGATCGCCACAGCAAAATA{CT}ACACCGCACAAGGCTTGAGGGACCGAAGGATGAGATTGTCGCTTCAAATAGCGCGCAAGTTCTTTGATCTCCAAGATATGTTAGGGTTTGATAAAGCGAGCAAAACCATCGAGTGGCTATTCGCCAAGTCGAAGAAGGCGATCAAAGAA---GTAACCCTAAAACACCCACAGATGAAG------------AACAATTTCCGCAATAGAGAGGAG---------------AAGAACGAGTCAATCATG---TCCGAATGTGAAGTG---------GAATCCACGATCGAGAACGTT---TAT---------------------------GGTGAAAAG------------------------------------------------------------------------GAAAAAGCTCAA------------------------------------------------------AAGGAGTCGAGGGCGAAAGCGA-------------------------- Dipelta_floribunda_3B ------------------------------------------------------------------------------------------------GACATGTTAGGGTTTGAAAAAGCGAGCAAAACGATAGACTGGCTTTTGGCCAAATCGAAAGGGGCAATCAAGGAA---CTCACGAAA------AACATACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCACGAACGGA---------AAAGGCGGTTGTGGG------TATTTCTCAGATTCATTCAAAGGCGAAAAGAATAAAAGA------------------------------GATTTG------GGA---AAGGCG---AGGGAGTC{AG}AGGGCAAAAGCAAGAGAAAGAGCAA-------------- Dipsacus_inermis_1 ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATTCTGGGATTCGAAAAGGCTAGCAAAACTGTCGACTGGTTACTAAGTCAATCAAGATCTGAGATTGAGGAGTTAACTAGAGGC---------------CATAACTCG---------------AGTATA---GGTGCA------------GCTAATAGCACATCTTCTGCT---TCCGAGTGTGAAGTG---------TTGTCTGGTACTGACCATGAGCCA---AAGCCTAAGTTGGGTAAA---AGTAAAGAAGAAGGGAAAGATTTGGGTGCAGCCAAGGATAAGGAGAAGGCCGCG---GATAAGAAGAAGAAG------AAGAAG---AAGAAG---AAAAAGGGA---------ATAGTT---ACTAGG---GTTGCATTTGACTCTACTGCCAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCA--------------- Dipsacus_inermis_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGACAAGGCGAGTCAAACACTCGACTGGCTA-TCAACAAGTCCAAAGCCTCCATCAAAGATTTGGTCCGGTCCAAGCTTGGC------TGT---ACTAGTACT---AGCACTAGTAATATCGACAAGTGTCGTACATTGACGTCAATT---------------TATGAGAGTGATGATGAT---GTGGATCCGCTTGAAACGCAAAATGTC------GACCTTGAG---------------------------------------GAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Dipsacus_inermis_2Ba ------------------------------------------------------------------------------------TT{CT}GACCT-CA{AG}GATATGTTAGGGTTTGACAAAGCAAGCAAAACCCTGGATTGGCTTTTCACTTGCTCCAAGGACTCAATTAATGAGCTGGCCAAGATGAAGATGACT------CGATGCATTAATACC---------------------------------------------------------------------------GATAGTAATAGTAATGGTAATAATAATAGTGAGACCGTT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGACGCG------TTCGATACGAGTTCTCGGGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Dipsacus_pilosus_1 AAAGACCGGCACAGCAAGATCAACACAGCCCATGGCCCAAGGGACCGGAGAATGAGACTCTCTCTCGATGTTGCCCGAAAGTTCTTTAGTCTCCAAGACATTCTGGGATTCGAAAAGGCTAGCAAAACTGTGGACTGGTTACTAAGTCAATCAAGATCTGAGATTGAGGAGTTAACTAGAGCC---------------CATAACTCG---------------AGTATA---GGTGCA------------GCTAATAGCACATCTTCTGCT---TCCGAGTGTGAAGTG---------TTGTCTGGTACTGATCATGAGCCA---AAGCCTAAGTTGGGTAAA---AGTAAAGAAGAAGGGAAAGATTTGGGTGCAGCCAAGGATAAGGAGAAGGCCGCG---GATAAGAAG------------AAGAAG---AAGAAG---AGAAAGGGA---------ATAGTT---ACTAGG---GTTGCATTTGACTCTACTGCCAGGGAGTCGAGGGCGAAGGCGAG-G-GCGAG-AAGGGCGA-------- Dipsacus_pilosus_2Ba ------------------------------------------------------------------------------------------------GATATGTTAGGGTTTGACAAAGCAAGCAAAACCCTAGATTGGCTTTTCACTTGCTCCAAGGACTCAATTAATGAGCTGGTTAAGATGAAGATGACT------CGATGCATTAATACTAATGCTAATAAT------------------------------------------------------------------AGTAATAGTAATAGTAATAATAATAGTGCTATCGTT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGACGCG------TTCGATACGAGTTCTCGGGAA------------------------------------------ Dipsacus_pilosus_2Bb ------------------------------------------------------------------------------------------------GATTTGTTAGGGTTTGACAAGGCCAGCAAAACCCTTGACTGGCTTTTCACCAGCTCAAAGGACTCAATTAGAGAGTTGGTTAATATGAAGATGAAGATGGCTAAATGCATTAATACTAATATTACTAATACTAATCCTAATCCTAAT---CCTATTGGTTGCTTGTATGAAATGGTG------------------------TATAATACTAATACTAATGAT---------------------------------------------AATAGTATAATAGAT------------------GGTAAGATTAGT------------------------------------------------------------AGGGATGCA------TTCCATTCGAGTTCGCGCGAG------------------------------------------ Dipsacus_pilosus_3B ------------------------------------------------------------------------------------------------GACGTGTTAGGCTTCGACAAAGCTAGCAAAACTATCGAGTGGCTTTTGGCCAAATCAAAAGGGGCAATCAAGGAA---CTCACCAGA------AACATACCG---------------------------------------------------------------------------------------------------------------------------------------------------------------AGCAGCATCAAT---------GGAGAAGGCAAATATGGG------TTGTTTTCTTGTTCGTTCGATGGCAAAAAGAACAAAAGG------------------------------GACTTG------GGA---ATGGCAATGAAGTCTTCCCGGGATATGGCAAGGGCAAAAGCGAGAGAAAGAGCAA-- Fedia_cornucopiae_1 -------------------------------------------------------------------------------------------------ACCCTCTCGGCTTTGAAAAGGCTAGCAAAACCATAGCATGGTTACTCTCCCAGTCCGAATCTGCCATCAAAGAGCTCTCTAGATCAGCC------------GTT---TTC---AACTCGTCGAGCAATAATCTGGGTGCT------------GTCAACAGCGCATCTTCCCCT---TCAGAGTGTGAGGTC---------TTGTCGGGCATCCAA---GAGCCAGCTAGGGTTGAATTGGCTAAG---------------------------------CCGAAAATGACA------------------------------------AAAGCT------AAA---AGAAAGGGTTCT---AATCCAGTT---AGGAGA---GCGGCATTTGACTCAATAGCAAGGG-------------------------------------------- Fedia_cornucopiae_2A -------------------------------------------------------------------------------------------------ATACACTAGGGTTTGATAAAGCAAGCCAAACACTAGATTGGCTACTAAACAAATCCAAATCAGCTATAAAGGATTTAGTTCAATCGAAGTTCGGT------TGT---ACAACTACA------------AATGTAAGT------AATAGTTTGAGTTCTATA---------------TACATGAGTGACGAAGAA---CTCGATCTGTCG------------GTGATT---GAAGACCTT---------------------------------------GAGAAGATT---------------AGT------------------TGTAAAGAA---AAGAGGCCG---AGATCGAAGCAA---------------------AGTTCAGCTGATCTTGCAGTGAAGGAATCTAGGGTTAGAGCAAGAGCAAGAGCAAGAGAAAGAACAAGA Fedia_cornucopiae_2Ba ------------------ATATACACAGCGCACGGTCCTCGAGATCGGAGAGTAAGATTGTCGATGGAAATTGCTAGAAAGTTCTTTGATCTTCAAGATATGTTAGGGTTTGATAAAGCAAGTAAAAGCCTAGACTGGTTGTTGACTAAATCAAAGGAATCTATTAAGGAATTGGTTAACATGAAGATGAAGATG------------------------AATAGTAATAAT---------------GGAAGTGGATGTTTGTTTGAAATGGTT---------------------TATAATAATAATAATATTAATAAT------------------------------------------------------------------------------GAGAAGATTATG------------------------------------------------------------AGAGATGCA------TTTGATTCAAGTTCAAGAGAATCTAGGGCAAAAGCAAGGGAAAGAGCAAGAGATAGAACAAAG Fedia_cornucopiae_2Bb --------------------------------------------------------------------------------------------------------------------------------CCTAGACTGGTTGTTGACTATATCCAAGGAATCCATTAAGGAATTGGTTAACATGAAGATGAAGATG------------------AATAATAATAAC---------------------GGAAGTGGATGTTTGTTTGAAATGGTG---------------------TATAATAATAATAATAATAATAAT------------------------------------------------------------------------------GAAAAGATTAAG------------------------------------------------------------AAAGATGCA------TTTGATTCCAGTTCAAGAAAATCCAAGGCAAAAGCCAGGGAAAGAACCAGAAATAAAACAAAG Fedia_cornucopiae_3A -------------------------------------------------------------------------------------------------ATATGTTAGGGTTTGATAAGGCAAGCAAGACCATCGAGTGGCTATTCACCAAGTCGAAGAAAGCAATCAAAGAA---GTTGCACTACAAAATTCACAAATGAAG------------ATGGATTTTCATAGAGAGGAACGG---------------------------ATCACA---TCCGCATGTGATGTA---------GAATCTACGATAGAAAATGTT---TAT---------------------------GGTGAAAAA------------------------------------------------------------------------GAAAGATGTCAG------------------------AGCATAGTT------TATGATCCGGTAGTAAGAGAGATGAGAGCTAGGGCAAGAGCTAGGGCTAGAGAACGAACACGA Fedia_cornucopiae_3B ------------------ATATGGACAGCTCAAGGAGTGAGAGCAAGAAGGATGAGATTACCCCTTCAGATTGCTAGAAAGTTCTTTGATCTTCAAGACATGTTGGGCTATGATAAAGCTAGTAATACTATTGAGTGGCTCATGTCCAAATCCACAGGGGCAATTAGGGAA---ATCACTAAG------AATATACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTCAAGGAAT---------ATGATCCAGAACGGAGAA---------------GATTTTTTACATTCATTAGAAGAT------------------------------------GATCCT------GAGGTGAAGAGGAGAAGAGTTGAGAGGGAAAAGGCAAGATCAAGAGCAAGAGAAGGAACAAAG Heptacodium_miconioides_1 AAAGA{CT}CGGCACAGCAAGATCAACACCGCCCACGGCCCCAGGGACCGCAGAATGAGACTCTCTCTCGATGTTGCTCGTAAGTTCTTTGGCCTCCAAGACATGCTTGGCTTCGACAAGGCCAGCAAGACCGTCGAGTGGTTACTCACCAAGTCGAAATCCTCTATCAAAGAACTCACCAGAGACGGTGGCGGT------------------------TCGTCCAGTGTG---GGTGCC---------------AATAGCGCATCTTCAACT---TCCGAGTGCGAGGTC---------TTGTCTGGGATCGAG---GACACG------CGCGTGGCTGAT---------------------------------ATTACTAAAGGGAAAGGCACCTCG------GGCGCC---------------AAGGCG---AAGAAG---GTCAAAGGG------------AGCTCTAGGAGA---GTTGCATTTGATGCTAATGCAAGGGAGTCGAGGGCAAAAGCAAGAGAAAGAGCAA-------------- Heptacodium_miconioides_2B -------------------------------------------------------------------------CGCGGAAGTTTTT{CT}GATCTGCAAGACCTACTAGGTTTCGACAAAGCCAGTAAAACCCTTGACTGGCTGTTGACCAACTCTGTGTCCGCAATCAAAGAGCTGGTCGAGATGAAAATGAAC------TGC---ACAACT---GCTGGCCCCTCAGCTGAAATGATACGTGAAAAT---------TATTACAGTGAGATGATG------------------------------------------------------------------------------------------------------GGTGTTGGGTTG------AACGAGAAA------------------------------------------------------------------AGGGACGCG------TTCGATAATAGTTCGAGAGAATCGAGGGCAAAAGCGAGAGAAAGAGCAAG------------- Heptacodium_miconioides_3A AAAGATCGCCACAGCAAAATATACACAGCGCATGGCCTGAGGGACCGGAGGATGAGATTGTCCCTTCAAATTGCGCGCAAGTTCTTCGATCTGCAAGACATGTTAGGGTTTGACAAAGCGAGCAAAACCATCGAGTGGCTATTCACCAAGTCGAAGAAGGCAATCAAAGAG---GTAACCCTAAACCACCCACAAATGAAG------------AACAAATGCCGCGGTTCTAGAGAG---------------AAGAACGAGTCATTCGTG---TCCGAATGTGAAGTA---------GAATCCGCGATCGAGAATGTT---AATGAT------------------------GGAGAGAGATTA---------------------------------------------------------------GAAAGGGGAAAAGCTCAA------------------------AAACTAGCG------TATGATCCTCTAGCGAGAGAGTCGAGGGCGAAAGCGAGAGCGA-------------------- Heptacodium_miconioides_3B AAAGACCGGCACAGCAAGATATTTACGGCTCAAGGTTTGAGAGCCAGGAGGATGAGATTACCCCTTCAAATTGCTCGAAGGTTCTTTGATCTACAAGACATGTTAGGCTTCGACAAAGCTAGCAAAACCATCGAGTGGCTTTTCGCCAAATCGAAAAAGGCCATCAAAGAA---CTCACCAAG------AACATCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------AACATGAATAAG---------AAAGGCGGCTGTGGG------CCTATTTCTTTTTCATCCGAAGGCGAAAAGAATAAAAGA------------------------------CAATTG------GGA---AAGGGG---AGGGAGTCGAGGGCGAAAGCGAGGGCGAG------------------- Knautia_calycina_1 ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATTCTTGGATTTGAAAAAGCTAGCAAAACTGTTGATTGGTTACTCAATCAATCAAGATCTGCCATTGAGGATCTCACTAGAGCC---------------CTAAACTTG---AACCACAGCTCGAGTATA---GGTGCA------------GCTAATAGCACATCTTCCGTT---TCCGAGTGTGAAGTA---------TTATCTGCTACTGATCATGAGCGA---AAGCCTCAGATG---------------------------------------GTTAAAGGAAAAGATAAAGGTTTG---GGTGCAGCC------------AAGGAT---AAGAAG---AGAAAGGGA---------AAAGTTATTACAAGG---ATAGCATTCGACTCTACTGCTAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Knautia_calycina_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTT{CT}GACAAGGCGAGTCAAACACT-GACTGGCTA-TCAACAAGTCCAAA---GCCATCAAAGATTTGGTC--GTCCAAGCTTGG-------TGT---ACTA-TACT---AGTAGTAG{CT}AATAT-G{AC}CAAGTGTCGTACTTTGAC-TCAATT---------------TACGAGAGTGATGACGA{CT}---GTGGATCCTCTCGA{AG}--GCATAATGT{CT}------GACCT-GAG---------------------------------------GAGGATGGC---------------------------------------AAAGAG---AAAAG--T----AGATCAAAGCA-AAA-TT------GATAAA---TCA-CACTTGATCTTGCAGCTAAAGAGTCTAGGGCTAAAGCTCGAGCTCGAGCAAGA------------ Knautia_calycina_2Ba_1 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGCTAGGGTTTGATAAAGCAAGCAAAACCCTAGATTGGCTTTT{CT}GCTTGCTCCAAGGACTCAATTAATGAGCTGATCAACATGAAGAAGATG---AGTTATTATAAT---------------------------------------------------------------------------------------AGTAATAGTAATAATAATAGT---ACATTTGCT---------------------------------------------------------------------GAGAAAAATTGT------------------------------------------------------------AGGGACGGA------TTTGGTACGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Knautia_calycina_2Ba_2 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTGATCAATATGAAGATGAGT---ACTCAGTGT------------------------------------------------------------------------------------------ATTAATAGTAAAAATAATAAT---AAAATTGCT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Knautia_calycina_2Ba_3 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTGATGAACATGAAGATGAGT---GCTCAATGC------------------------------------------------------------------------------------------ATTAATAGTGATTGTAAT------AAGGTTGCT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Knautia_calycina_2Bb_1 ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATTTGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCA{CT}CAGCTC{AT}AAGGACTCAATTAAAGAGTTGGTTAATA{GT}GAAGATGAAGATGA{CG}TAAATGCATT---A{AG}T{AG}CTAATA{CT}T---------------------AATCCTACTGG{AT}TGCTTGTATGAAATGGTG---------------------TATAATACTAATAAT{AG}ATACT------------------------------------------------AAT{AT}GTTTAGTA{AGT}TT------------------GAGAAGAT{CT}AA{CT}------------------------------------------------------------AG{AG}{AG}ATGCA------TTCGATACG{AC}G{GT}TCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Knautia_calycina_2Bb_2 ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGT-TGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTC{AG}AAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATC{CT}ATT---AATAATAT{GT}AAT---ACTAATACTTAT------AATCC{AC}ACTGGATGCTTGTATGAAATGGTG---------------------TATAATACTACAACTA{AC}TAAT------------------------------------------------AATTATAATAATGGTATG---------------GAAAA{AG}ATTAGT------------------------------------------------------------AGAGATGCA------TTTGGTATGAGTTCTAAAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Knautia_calycina_3Ba ------------------------------------------------------------------------GCGCG{AT}AGGTT{CT}TTCGATCT{AG}CAAGATA{CT}GTTAGGGTTTGACAAAGCTAGCAAAACCATTGAATGGCTTTTG{GT}CTAAATCAAAAGGGGCGATCAAGGAA---CTCACCAGA------AACTTACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAGTACCACC{AG}GT---ATTGGAGAAGGCAATTGTGTG------TTCTTTTCTGGTTCGTCCAAAGGCGATAAGAACAAAAGG------------------------------GACATG------GGAATAATGGCAGTGAAGTTGTCTCGGGCAAAAGCAAGAGAAAGAGCAAGA------------ Knautia_calycina_3Bb ------------------------------------------------------------------------GCGCGAAATTTTTTTGACCTCCAGGACATGTTAGGTTTGGACAAAGCTAGCAAAACCATTGAGTGGCTTTTGGCCAAATCAAAAGGAGCAATTAAAGAA---GTCACCAGA------AACTTACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------TCCAGCATCAAT---------GGAGAAGGCAATTATGGG------TTCTCTTCTGGTTCATCCGAGGGTAAAAAGAACAAAATG------------------------------GAATCG------AGA---ATCGGAATGAAGTCGTCGCGGGCGAAAGCAAGAGAAAGAGCAAGA------------ Knautia_macedonica_1 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTAAACTTG---AACCACAGCTCGAGTATA---GGTGCA------------GCTAATAGCACATCTTCCGTT---TCCGAGTGTGAAGTA---------TTATCTGGTACTGATCATGAGCGA---AAGCCTCAGATG---------------------------------------GTTAAAGGGAAAGATAAAGGTTTG---GGTGCAGCC------------AAGGAT---AAGAAG---AGAAAGGGA---------AAAGTT---ACAAGA---ATAGCATTCGACTCTACTGCTAGGGAGTTGAGGGC---------------------------------- Knautia_macedonica_2A ---------------------------------------------------------------------------------------------------------------------------------------------------------------GCCATCAAAGATTTGGTATTGTCCAAGCTTGGA------TGT---ACTACTACT---AGTAGTAGCAATATTGACAAGTGTCGTACTTTGACTTCAATT---------------TACGAGAGTGATAACGAC---GTGGATCCTCTCGAGCTGCATAATGTT------GACCTAGAG---------------------------------------GAGGATGGC---------------------------------------AAAGAG---AAAAGGTTG---AGATCAAAGCAAAAATTT------TATAAA---TCAGCACTTGATCTTGCAGCTAAGGAGTCTAGG------------------------------------ Knautia_macedonica_2Ba -------------------------------------------------------------------------------------------------------------------AAGCAAGCAAAACCCTAGATTGGCTTTTCGCTTGCTCCAAGGACTCAATTAATGAGCTGATCAACATGAAGAAGATG---AGTTATTATAAT---------------------------------------------------------------------------------------AGTAATAGTAATAACAATAGT---ACATTTGCT---------------------------------------------------------------------GAGAAACATTGT------------------------------------------------------------AGGGACGGA------TTTGGTACGAGTTCT------------------------------------------------ Knautia_macedonica_2Bb -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCTACTGGATGCTTGTATGAAATGGTG------------------------TATAATACTGATAATGAT---ACT------------------------------------------AATTGTTTAGTATTT------------------GAGAAGATCAAC------------------------------------------------------------AGAAATGCA------TTCGATACGCGTTCTCGAGAATCTA-------------------------------------- Knautia_macedonica_3A ------------------------------------------------------------------------------------------------------------------------------------------------------------AAGGCTATAAGAGAA---GTAACCCTAAAACACCCACACATGAAG------------AATAATTTACGTAATAGAGGGGCG---------------AA{AG}---ATGTCAGTCACATCATCTGAATGTG{AG}AATG---------ATC---------------------------------------------------GACGAAAAG------------------------------------------------------------------------GCGAAAATTCAA------------------------AGTTTTGTT------TTTGATCCGGTTGCAAGAGAGATGAGGAACAAGGCTA-------------------------- Knautia_macedonica_3Bb -----------------------------------------------------------------------------------------------------------------------------------------------------ATCAAAAGGAGCAATTAAAGAA---GTCACCAGA------AACTTACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------TCCAGCATCAAT---------GGAGAAAGCAATTATGGG------TTCTCTTCTGGTTCATCCGAGGGTAAAAAGAACAAA------------------------------------------------------------------------------------------------------------ Kolkwitzia_amabilis_1 AAAGACCGGCACAGCAAAATCAACACGGCCCACGGCCCTAGGGACCGGAGAATGAGACTCTCTCTTGATGTTGCACGAAAGTTCTTCGGTCTCCAAGACATTCTCGGCTTCGACAAGGCCAGCAAAACCGTTGAGTGGTTACTCACTCAATCGAATTCTGCCATCAAGGACCTCACTAGAGCTGTCAAAGGC------CTTAACTCG---AACCACAGCTCGAGTGTG---GGTGCC---------------AATAGCACGTCTTCCACT---TCTGAGTGCGAGGTC---------TTGTCTGGTACCGAT---GAGCCA---AGGGGTCAGTTGGCTAAG---------------------------------GCTAAAGGGAAA---------------GGATCAGGTTCG---------AAGGAT---AAAAAG---AGAAAAGCA---------ACAGTT---AGGAGA---GTTGCATTTGACTCTACCGCAAGGGAGTTGAGGGCAAA{AG}GCAAGAGAAAGAGCAA-------------- Kolkwitzia_amabilis_2A ------------------------------------------------------------------------GCGCGTAATTTCTT{CT}GG{CT}CTCCAAGACACGTTGGGATTCGACAAGGCCAGCCAAACACTCGACTGGCTACTAAACAAGTCCAAAGCCGCTATCAA{AG}GATTTGGTCCACTCGAAGCTCGGC------TGT------ACC------AACAGTAGC---ATTGCAAAC---TGTACTTTGACTTCCATT---------------TACGAGAGTGATGATGAC---GTGGCTCCCTCAGAAACCCACA{AG}TATTATA---GACCTCGAG---------------------------------------GAGGACGGG---------------AAAATG---------------GTTAAAGAG---AAAAAATCG---AGA---AAGCAA---ACG------GATAAA---TCCGCAATTGATCTTGCAGCTAAAGAGTCTAGGGCGAAGGCGAGA-AAAGAGCAA-------------- Kolkwitzia_amabilis_2B ------------------------------------------------------------------------GCGCGGAGGTTTTTCGATCTGCAAGACATGCTAGGTTTTGACAAAGCAAGCAAAACCCTGGACTGGCTTTTGAACAACTCGAAGGACTCCATTAAAGAGCTGGTCCATATGAAGACGAAG------ATC---AGTACTCATAATACTAATTGTAATAATACTACGGGA---------------TGTCTGTTCGAAATGGTG---------------------TATAATAATAAT---------------------------------------------------------------------GGTGTTGGG---------AATGAGAAGATT---------------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCGAGAGAGTCCAGGGCAAAGGCGAGGGAAAGAGCAA-------------- Kolkwitzia_amabilis_3A AAAGATCGCCACAGCAAAATATACACCGCACAAGGCTTGAGGGACCGAAGGATGAGATTGTCCCTTCAAATAGCGCGCAAGTTCTTTGATCTCCAAGATATGTTAGGATTTGATAAAGCGAGCAAAACCATCGAGTGGCTATTCGCCAAGTCGAAGAAGGCGATTAAAGAA---GTAACCCTAAAACACCCACAGATGAAG------------AACAATTTCCGCAATAGAGAGGAG---------------AAGAACGAGTCAATCACG---TCCGAATGTGAAGTG---------GAATCCCCGATCGCGAACGTT---TAT---------------------------GGTGAAAAG------------------------------------------------------------------------GGAAAAGCTCAA------------------------------------------------------AAGGAGTCGAGGGCGAAGGCGAGGGCGAG------------------- Kolkwitzia_amabilis_3B AAAGACCGCCACAGCAAGATCTATACAGCTCAGGGTGTGAGAGCAAGGAGGATGAGGTTACCCCTTCAAATTGCTCGAAGGTTCTTCGATCTGCAAGACATGTTAGGGTTTGACAAAGCGAGCAAAACGATCGACTGGCTTTTGGCCAAATCGAAAGGGGCAATCAAGGAA---CTCACAAAA------AACTTACCA------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCAGGAACGGA---------AAAGGCGGTTGTGGG------TATTTTTCAGATTCGTTCAAAGGCGGAAAGAATAAAAGA------------------------------GATTTG------GGA---AAGGCG---AGGGAGTCGAGGGCAAAGGCAAGGGAAAGAGCAA-------------- Leycesteria_formosa_1a AAAGACCGGCACAGCAAGATCAACACCGCCCACGGCCCTAGGGACAGGAGAATGAGACTCTCTCTTGATGTTGCTCGTAAATTCTTTGGCCTCCAAGACATGCTCGGCTTCGACAAGGCCAGTAAAACCGTCGAGTGGTTGCTAACTAAGTCAAAATCCGCTATCAAAGACCTCACCAGAGGC---------------CTTAACTCC---AACCACAGTTCCAGTGTT---GGTGCC---------------AATAGCGGGTCTTCAACT---TCTGAGTGCGAGGTC---------TTGTCTGGTACTGAG---GATACA---CGCCGCGTGTCCAAC------ACTACTACTACTACT---------ACTAGTACTAAGGGGAAAGGCACGGTCGTC---GGG------------------AAGGCG---AAGAAG---AATAAAGGG------------GTCACTAGGAGA---ATCGCATTTGATGCTAATGCAAGGGAGACGAGGGCGAAAGCGA-------------------------- Leycesteria_formosa_2A AAAGATCGGCACAGCAAAATTTACACGGCCCAAGGACCTCGTGACCGGAGGGTAAGATTGTCAATTGAAATAGCCCGAAAGTTCTTTGATCTCCAAGACATGTTGGGGTTCGACAAGGCGAGCCGAACACTTGATTGGCTACTCAACAAATCCCAAACAGCCATAAAAGATTTGGTACAGTCGAAGCTCGGC------TGT---ACC---------AGCAGTAGTGATGCAAGG------TGTAGTTTGAGTTCCATT---------------TACGAATACGAATCA------------------GACAAGCACAAA------------TTAGACCCG------------------------------------GAGAATGGGGAA---------------------ATCGCGAGTGGGGTTAAAGAA---AAAAAGTTGAGAAAGCCA---------GCA------GATAAATCTTCAGTTATTGATCTCGCGGCTAGAGAGTCGAGGGCGAAAGCGAGGGCGAG------------------- Leycesteria_sp_1b AAAGACCGGCACAGCAAGATCAACACCGCCCACGGCCCTAGGGACAGGAGAATGAGACTCTCTCTTGATGTTGCTCGTAAATTCTTCGGCCTCCAAGACATGCTCGGCTTCGACAAGGCCAGTAAAACCGTCGAGTGGTTGCTAACTAAGTCAAAATCCGCTATCAAAGACCTCACCAGAGGC---------------CTTAACTCC---AACCACAGTTCCAGTGTT---GGTGCC---------------AATAGCGGGTCTTCAACT---TCTGAGTGCGAGGTC---------TTGTCTGGTACCGAG---GATACA---CGCCGCGTGTCCAAC------ACTACTACTACTACTACT---ACTACTAGTATTAAGGGGAAAGGCATGGTCGTCGTCGGG------------------AAGGCG---AAGAAG---AATAAAGGG------------GTCACTAGGAGA---ATCGCATTTGATGCTAACGCAAGGGAGTCGAGGGCGAA{AG}GCGAGGGCGAGAACGA-------------- Linnaea_borealis_1 AAAGACCGCCACAGCAAGATCAACACGGCCCACGGCCCTAGGGACCGGAGAATGAGACTCTCTCTCGATGTTGCACGAAAGTTCTTCGGTCTCCAAGACATTCTCGGCTTCGACAAGGCCAGCAAAACCGTCGAGTGGTTACTCACTCAATCGAAATCCGCCATCAAGGACCTCAGTAGAGCCATCAAAGGC------CTTAACTCG---AACCATAGCTCGAGTGTG---GGTGCC---------------AATAGCACGTCTTCTACT---TCCGAGTGCGAGGTC---------TTGTCTGGTACCGAT---GAGCCG---AGGGGTCATTTGGCTAAG---------------------------------GCTAAAGGGAAA---------------GGATCGGGTTCG---------AAGGAT---AAAAAG---AGAAAGGCG---------ATTGTT---AGGAGA---GTTGCATTTGACTCTACCGCTAGGGAG{AT}CGAGGGCGAAGGCGAGAGCGAG------------------- Linnaea_borealis_3A AAAGATCGCCACAGCAAAATA{CT}ACACCGCACAAGGCTTGAGGGACCGGAGGATGAGGTTGTCCCTTCAAATAGCGCGCAAGTTCTTTGATCTCCAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCATCGAGTGGCTATTCGCCAAGTCGAAGAAGGCGATTAAAGAA---GTAACCCTAAAACACCCACAAATGAAG------------AAAATTTTCCACAATAGAGAGGAG---------------AAGAACGAGTCAATCTCG---ACCGAATATGAAATA---------GATTCCGCGATCGAGAACGTT---TAT---------------------------GGTGAAAAG------------------------------------------------------------------------GGGAAAGCTCAA------------------------------------------------------AAGGAGTCGAGGGCGAAGGCGAGGGCGA-------------------- Lomelosia_crenata_1B -------------------------------------------------------------------------------------------------------------------------------CGGTTGATTGGTTACTCGATCAATC{AG}AGATC-GCCATTGAGGATCTCAC-AAATTAGCC------------CTTAATTCG---AACCACAGCTCGAGTGTA---------------------GCTAGAACAACATCTTCAGCT---TCTGAGTGTGAAGTT---------TTGTCTGGTA-TGATCATGAGGCA---AAGGCTGAG-T----------------------------------------GGTAAGGGTAAAGGGAAAA-TTTG---GGTG--GGC------------AAAGAT---AAGAAG---AGAAAGGGA---------ATGGTT---ACAAGG---GTTGCAT-TGACTCTAATGCAAGGGAG{AG}----------------------------------------- Lomelosia_crenata_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGACAAGGCAAGTCAAACACTTGACTGGCTACTCAA-AAGTCCAAAGCTGCCATTAAAGATTTGGTCAAGTCCAAGCTTGGC------TGT---AGTAGTACT---AGTAGTAGTAATATCGCCAAGTGTCGTACATTGACTATGATT---------------TATGAGAGCGATGATGAT---GTGAGTCCTCTTGAGACACATAATGTTGTTGATGATCTTGAG---------------------------------------GAGGATGGG---------------AAA------------------ATAATGGCAGAGAAAAGGGTG---AAATCAAAGCAGAAGGCT------GATAAA---TTGCCAGTTGATCTTGCAGCTAAAGAATCTAGGGCTAAAGCTCGAGCTCGAGCAAGA------------ Lomelosia_crenata_2Ba_1 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGCTAGGGTTTGATAAAGCAAGCAAAACCCTAGATTGGCTTTT{CT}GCTTGCTCCAAGGACTCAATTAATGAGCTGATCAACATGAAGAAGATG---AGTTATTATAAT---------------------------------------------------------------------------------------AGTAATAGTAATAATAATAGTACA---TTTGCT---------------------------------------------------------------------GAGAAAAATTGT------------------------------------------------------------AGGGATGGA------TTCGGTACGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Lomelosia_crenata_2Ba_2 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATTTGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAGT---GCTCAATGCATT------------------------------------------------------------------------------------------AATAGTGATTGT------AATAAGGTTG{AC}T---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Lomelosia_crenata_2Bb ------------------------------------------------------------------------GCCCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATCCAT{CT}---AATAATATTAAT---ACTAATACTTAT------AATCC{AC}ACTGGATGTTTGTATGAAATGGTG---------------------TATAATACTAATAATAATAATAATAATAATCATAATAATGGT---------------------------------------------------------ATTGAAAA{AG}ATTAGT------------------------------------------------------------AGAGATGCA------TTTGGTATGAGTTCTAAAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Lonicera_heteroloba_1 AAAGATCGGCACAGCAAGATCAACACCGCCCACGGCCCTAGGGACAGGAGAATGAGACTCTCTCTTGATGTTGCTCGTAAGTTCTTCGGCCTCCAAGACATGCTCGGCTTCGACAAGGCCAGTAAAACCGTCGAGTGGTTGCTAACTAAGTCAAAATCCGCTATCAAAGATCTCACCAGAGGC---------------CTTAACTCC---AACCACAGTTCCAGTGTT---GGTGCC---------------AACAGCGCGTCTTCCACT---TCTGAGTGTGAGGTC---------TTGTCTGGTACTGAC---GACACG------CGCGTGTTAAACGAG---GATACACACCGCATATCC---AACACTAGTACCAAGGGGAAAGGCACCGTC------GGG------------------AAGGCG---AAGAAG---AGTAAAGGG---------GTCGTCACTAGGAGA---ATCGCATTCGATGCTAACGCCAGGGAGTCGAGGGCGAAAGCGAGAGCGAG------------------- Lonicera_heteroloba_2A AAAGACCGGCACAGCAAAATTTATACGGCCCAAGGACCTCGTGACCGGAGGGTAAGATTGTCGATTGAAATAGCCCGGAAGTTCTTTGATCTCCAAGACATGTTGGGGTTCGACAAGGCGAGCCGAACTCTTGATTGGCTACTCAACAAATCCAAAATCGCCATAAAAGATTTGGTACAGTCGAAGCTCGGC------TGT---ACC---------AACAGTAGTGATGCAAGG------TGTAGTTTGAGTTCCATT---------------TACGAATGCGAATCA------------------GACAAGCACACA------------TTATACCCG------------------------------------AAGAATGGAGAA---------------------ATCGCGAGCGAGATTAAAGGA---AAAAAGTTGAGAAAGCCA---------ACA------GATAAATCTTCAGTTATTGATCTTGCGGCCAGGGAGTCGAGGGCGAAAGCGAGAGCGAG------------------- Lonicera_heteroloba_2B ------------------------------------------------------------------------------------------------GACTTGCTGGGTTTTGACAAAGCGAGTAAAACCCTTGACTGGCTGCTGACCCACTCAAAGGCGGCGATCAAAGAGTTGGTCCGGATGAAAATCAAC------TGC---ACTACT------GGGGGCGGGGGC---------AGT------------------------GAAATGATATGTGAA------AATAATAATTATTGTAACAAGAACGAGACGACTAGT------------------------------------------------------GTTGTTGGG---------AACGAGAAG------------------------------------------------------------------AGGGATGCT------TTTGATATTAGTTCGAGAGAATCGAGGGCAAAGGCGAGGGAAAGAGCAA-------------- Lonicera_heteroloba_3Aa ------------------------------------------------------------------------------------------------GACATGTTAGGGTTCGATAAAGCAAGCAAAACCATCGAGTGGCTATTCTCCAAGTCGAAGAAGGCCATCAAAGAA---GTAACCCTAAACAACCCTAAAATGAAG------------AATACT------------AGAGAG---------------AAGAATGGGTCAATTGTG---TCTGAATGTGAAGTA---------GAATCCGCAATCGAAAATGTT---AAT------------------------------------------------------------------------------------------------------GGAGGGGGAAAAGCTCAA------------------------AAAGTAGCT------TGTGGTCATCTGGCACGAGAATCGAGGGC{AG}AA{AG}GCAAG{AG}GAAAGAGCAA-------------- Lonicera_heteroloba_3Ab ------------------------------------------------------------------------------------------------GACATGTTAGGGTTCGATAAAGCAAGCAAAACCATCGAGTGGCTATTCTCCAAGTCGAAGAAGGCCATCAAAGAA---GTAACCCTAAACAACCCTATAATGAAG------------AATACT------------AGAGAG---------------AAGAATGAGTCAATTGTG---TCTGAATGTGAAGTA---------GAATCCGCAATCGAAAATGTT---AAT---------------------------GGAGAGAGATCA---------------------------------------------------------------GAAAGGGGAAAAGCTCAA------------------------AAAGTAGCT------TGTGGTCATCTGGCACGAGAATTGAGGGCGAAAGCAAGAGAAAGAGCAA-------------- Lonicera_reticulata_2A AAAGACCGGCACAGCAAAATTTACACGGCCCAAGGACCTCGTGATCGGAGGGTAAGATTGTCAATTGAAATATCCCGGAAGTTCTTTGATCTCCAAGACATGTTGGGGTTCGACAAGGCGAGCCGGACACTTGATTGGCTACTCAACAAATCCCAAACCGCCATAAAAGATTTGGTACAGTCGAAGCTCGGC------TGT---ACC---------AGCAGTAGTGATGC{AG}AGG------TGTAGTTTGAGTTCCATT---------------TACGAATGCGAATCA------------------GACAAGCTCAAA------------TTAGACCCG------------------------------------GAGAATGGAGAA---------------------ATCGCGAGTGAGATTAAAG{AG}A---AAAAAGTTGAGAAAGCCA---------ACA------CATAAATCTTCAGTTATTCATGTTGCAGCTAGAGAGTCGAGGGCGAAAGCGAGAGCGAG------------------- Lonicera_reticulata_3A AAAGATCGGCACAGCAAAATCTACACAGCACAAGGCTTGAGGGACCGGAGGATGCGATTGTCCCTTCAAATTGCGCGCAAGTTCTTTGATCTACAAGACATGTTAGGGTTTGATAAAGCAAGCAAAACCATCGAGTGGCTATTCTCCAAGTCGAAGAAGGCTATCAAAGAA---GTAACCCTAAACCACCCTAAAATGAAG------------AATACT------------AGAGAG---------------AAGAAAGAGTCAATTGTG---TCTGAATGTGAAGTA---------GAATCCGCGATCGAAAATGTT---AAT---------------------------GGAGAGAGAACA---------------------------------------------------------------GAAAGGGGAAAAGCTCAA------------------------AAAGTAGCT------TGTGGTCATCTGGCACGGGAGTCGAGGGCGAAAGCGAGAGCGAG------------------- Lonicera_reticulata_3B AAAGACCGGCACAGCAAAATATTTACTTCTCAGGGTTTGAGGGCTAGGAGGATGAGATTACCCCTTCAAATCGCTCGAAGGTTCTTCGATCTACAAGACCTATTAGGCTTCGACAAAGCTAGCAAAACCATCGAGTGGCTTTTCGCCAAATCAAAAAAAGCCATCAAAGAA---CTCACCAAG------AATATCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------AACATGAACGAA---------AAAGGCAAATGTCAG------ACTTTTTCCGATTCATTTGAAGGCGAAAAGAATAAAAGA------------------------------GAATTG------GGA---AAGGCG---AGGGAGTCGAGGGCGAAGGCGAGAGCGA-------------------- Morina_longifolia_2Ba ------------------------------------------------------------------------------------------------GACCTGTTAGGTTTTGACAAGGCAAGCAAAACCCTTGACTGGCTGTTGACCAACTCCAAGGACTCCATTAAAGAGCTGGTCCGAGTGAAGAAGACC---CAATGC---AATTCCTTTGATAATAATAGTAAT---------------AAAGGCACCGGATGTCTGTTTGAAATGGTT---------------------TATAATAATAATAATAATAATAAT---------------------------------------------------GGGGGAGTAGTTGGGAAT------GTTGAGAAGATT---------------------------------------------------------------AGAGATGCA------TTTGATATGAGTTCGAGAGAGTCGAGGGCAAA{AG}GCAAGAGAAAGAGCAA-------------- Morina_longifolia_2Bb ------------------------------------------------------------------------------------------------GACATGTTAGGTTTTGACAAAGCAAGCAAAACCCTTGACTGGCTGTTGACCAACTCCAAGGACTCCATTCAAGAGCTGGTCCATATGAAGAAGACC---TTGGAT---AATAATAATAATAATAATAATAATAAT------------AAAGGGTCGGGATGTCTATTTGAAATGGTT---------------------TATAATAATAATAATAACAATAATAAT---------------------------------------GATGATGATGGAGGAGTCGTT------------GTTGAGAAGATG---------------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCTAGAGAGTCGAGGGCAAAGGCAAGAGAAAGAGCAA-------------- Morina_longifolia_3Ba AAAGA{CT}CGCCACAGCAA{AG}ATCTCTACAGCTCAGGGGGTGAGAGCTAGGAGGATGAGGTTACCCCTTAAAATAGCTCGAAAGTTCTTCGATCTGCAAGACATGTTAGGGTTTGAAAAAGCGAGCAAAACAATAGAGTGGCTTTTGGCCAAATCAAAAGGAGCCATCAAGGAA---CTCACAAAA------ACCATACCA---------------------------------------------------------------------------------------------------------------------------------------GTTATCACA------------------AATATTGGGGATCAAGGC------------------------ATTTCAGAATATTCGTCAGAAGGTGAAAGGAACAAAAGA------------------------------GAATTG------GGAACTAAGGCGGCAAGGGAGTCAAGGGCAAAAGC{AG}AG{AG}GAAAGAGCAA-------------- Morina_longifolia_3Bb AAAGA{CT}CG{CG}CACAGCAA{AG}ATCTGTACAGCTCAGGGAGTGAGAGCTAGGAGGATGAGGTTACCCCTTAAAATAGCTCGAAAGTTCTTCCATCTGCAAGACATGTTAGGGTTTGACAAAGCCAGCAAAACGATCGAGTGGATGCTGGCCAAATCAAAAGGGGCCATCAAGGAA---CTCACAGA{AG}AAA---CCCATACCA------------------------------------------------------------------------------------------------------------------------------------------ATTACCACG---------------AATATTGGGGATCAGTGC------------------------ATTTCAGAGTATTCGTCAGAAGGCGAAAGGAACAAAAGG------------------------------GAATTG------GGA---AAGGCTGCGAGGGAGTCAAGGGC{AG}AAAGC{AG}AGAGAAAGAGCAA-------------- Patrinia_triloba_1 AAAGATCGGCACAGCAAGATCAACACTGCACATGGCCCTAGGGACCGGAGAATGAGACTCTCTCTTGATGTTGCTAGAAAGTTCTTCGGTCTCCAAGACCTTCTCGGCTTCGAAAAGGCCAGCAAAACCGTCGAATGGTTGCTCACTCAATCAAAATCTGCCATCAAGGATCTCACTAGAGCAATCAACGGC------CTTAACTCCTCGAACCGTAGCTCGAGTAATCTGGGTGTA------------GCCAATAGCGCTTCTTCCACT---TCCGAGTGCGAGGTC---------TTGTCAGGTATCGAT---GAGCCG---AGGGTTCAATTGACTAAG---------------------------------GCTAAAGGGAAAGGTTCTGGTTCA------------------------AAGGAT---AAGAAA---AGAAAGGAG---------ATAGTT---AGGAGA---GCTGCATTTGACTCTACCGCGAGGGAGTCGAGGGCGAAAGCGAGAG--CGAG-AAGGGC---------- Patrinia_triloba_2A ------------------------------------------------------------------------------------------------GACACGTTGGGATTCGACAAGGCGAGCCAAACACTAGACTGGCTACTCAACAAGTCCAAAGCCGCCATCAAAGATTTGGTTCAATCCAAGCTCGGC------TGCAGTACTAGC------AGTAGTAGTAATATCGCTAAGTGCACTACTTTGACTTCCATT---------------TACGAGAGCGACGATGAC---GTGGATCCCTCAGAGAGTACCCATAATATA---GACCTCATGGGG------------------------------------GAGCATGGG---------------AAAAAT---------------TTTAAAGAG---AAAAAGTCG---AGATCAAAGCAA---ACG------------------GCCGTTGATCTTGCTGCTAAAGAGTCTAGGGCAAAGGCAAGAGAAAGAGCAA-------------- Patrinia_triloba_2B ------------------------------------------------------------------------------------------------------TTGGGTTTTGACAAAGCAAGCAAAACCCTCGACTGGCTGT{CT}GACAAACTCGAAGGAATCCATTAAAGAGCTGATCCACATGAAGACCAAG------ATC------------------AATAATAAT---------------------AGTGGATGTTTGTTCGAAATGGTG---------------------TATAATAATAATAATAATAG{CT}AAAAATAATAAT------------------------------------------------------GGGAATGGG---AATGAGAGGATAAAT------------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCGAG{AG}GAATCTAGGGC{AG}AA{AG}GCAAGAGAAAGAGCAA-------------- Patrinia_triloba_3B ------------------------------------------------------------------------------------------------GACATTTTAGGCTTCGACAAAGCTAGCAAAACCATCGAGTGGCTTTTGGCCAAATCAAAAGGGGCTATCAAGGAA---CTCACGGAA------AATATACCG---------------------------------------------------------------------------------------------------------------------------------------------------------------AGCAGCACGAGC---------GGAAAAGGTGATTGTGGG------TCTTTT{GT}CAGATTCTTCCGAAGGCGAAAAGAACAAAAGA------------------------------AAATTG------GTA---AAGGCG---AAGGAGATGAGGGC{AG}AAAGCAAG{AG}GAAAGAGCAA-------------- Pseudoscabiosa_limonifolia_2Ba ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGACAAAGCAAGCAAAACCCTAGATTGGCTTTTCACATGCTCCAAGGACTCAATTAATGAGCTGGTTAACATGAAGATGACT------CAGTGCTATAATACTAATGCTAATAATCGT---------------------------------------------------------------------AGTAATTGTAATAGTAATAGTAAGATTGTT---------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTATATACGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pseudoscabiosa_limonifolia_2Bb ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACCAGCTCCAGGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAAGGCTGCATTAATTATAATAATAATAATATTAATACT---AAT---CCTATTGGGAGCTTGTATGAAATGGTG------------------------TATAATACAAATATTAATACT---------------------------------------------AATGGATTAGTAGCT------------------GAGAAAATTAATGGT---------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCTCGAGAGTCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pseudoscabiosa_limonifolia_3B ------------------------------------------------------------------------GCGCGGAGGTTTTTCGATCTGCAAGACATGTTAGGCTTAGACAAAGCTAGCAAAACCATCGAGTGGCTTTTGGCCAAATCTAAAGGGGCAATCAAGGAA---ATCAACAGA------AACATACCA---------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAGCATCAAT---GGAGAAGAACAAAAGGGTTATGGG------TTCTTTTCTGGTTCGTCTGAGGGTGAAAAGAAGAAAAGG------------------------------GATTTG------GGA---ATGGCAATGAAGTCGTCCCGGGATAAGGCAAGGGCAAAAGCAAGA------------ Pterocephalus_strictus_1Ba ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCTAGCAAAACGGTTGATTGGTTACTCGATCAATCAAGATCCGCCATTGAGGATCTCACAAAATTAGCC------------CTTAATTCG---AACCACAACTCGAGTGTA---------------------GCTAGAACAACATCTTCAGCT---TCTGAGTGTGAAGTT---------TTGTCTGGTACTGATCATGAGGCA---AAGGCTGAGTTA---------------------------------------GGTAAGGGTAAAGGGAAAATTTTG---TGTGCAGGC------------AAAGAT---AAGAAG---AGAAAGGGA---------ATGGTT---ACAAGG---GTTGCATTTGACTCTAATGCCAGGGAGTT{AG}AGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_1Bb ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCAAGCAAAACTGTTGATTGGTTACTAGATCAATCAAGATCTGCCATTGAGGATCTCACTAAATTAGCC------------CTTAGCTCG---AACCACAGCTCAAGTGTAGTAGGTGCAGTTAAGCACTTAACTAGAACAACATCTTCGGCT---TCCGAGTGTGAAGTT---------TTGTCTGGTACTGATCATGAGCCA---AAGCCTGAGTTGGCC------------------------------------GGTAAGGTTAAAGGGAAAAGTTTG---GGTGCAGGCAGC---------AAGGAT---AAGAAG---AGAAAAGGA---------ATAGTT---ACAAGG---GTTGCATTTGATTCTAATGCAAGGGAGTT{AG}AGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGATAAGGCAAGTCAAACACTTGACTGGCTACTCAACAAGTCCAAAGCTGCCATTAAAGATTTGGTCAAGTCCAAGCTGTGC------TGTAGTAGTACT------AGTAGTAGTAATATTGCCAAGTGTCATACATTGACTACCATT---------------TACGAGAGCGATGATGAT---GTGGATGCGCTTGGGACACATAATGTTATT---GACCTTGAG---------------------------------------GAGGATGGG---------------AAAATT---------------ATTACAGAG---AGAAGGGTG---AGATCAAAGCAGAAGGCT------GATAAA---TCACCAGTTGATCTTGCAGCTAAAGAGTCTAGGGCTAAAGCTCGAGCTCGAGCAAGA------------ Pterocephalus_strictus_2Ba_1 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGACATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCAATTGCTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAAT---ACTCAAAGCATT---AAA------------------------------------------------------------------------TGTGATAGT---AATAGTAAAAATAATAAT---------------------------------------------------------AAAATTGCT---------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGACTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_2Ba_2 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGTTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAAT---ACTCAAAGCAAT---AAA------------------------------------------------------------------------TGTGATAGTACTAATAGTAAAAATAATAAT---------------------------------------------------------AAAATTGCT------------CATGAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGACTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_2Ba_3 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTCATCAACATGAAGAAGATG---ACTACTGTTAAT------------------------------------------------------------------------------TGTGAT---GGTAATAGTATTAATGATAAA------------------------------------------------------GA{CT}AAGGTTGCT---------------CAGAAGATTTTTAGG---------------------------------------------------------GGTAC{CT}GGA------TTCGATTCCACTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_2Bb_1 ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACCAAATCCATT---AATAATATTAAT---ACTAATTATTAT------AATCCCACTGGATGTTTGTATGAAATGGTG---------------------TATAATACTAATAATAATAAT---AATGGTAGT------------------------------------------------------------------ATTGAAAAAATTAGT------------------------------------------------------------AGAAATGCA------TTTGGTATGAGTTCTAGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_2Bb_2 ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}G{AG}TCT-CA-GATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATCTATT---AATAATATTAATATGATTAATACTTATAAT---AATCCCACTGGTTGCTTGTATGAAATGGTG---------------------TATAATACTAATAATAATGGT------ATT------------------------------------------------------------------------GAAAAAATTAAT------------------------------------------------------------AGAGATGCA------TTTGGTACAAGTTCTAAAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pterocephalus_strictus_3A ------------------------------------------------------------------------GCGCGTAATTTTTTTGGCCTCCAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCATTGAGTGGTTGTTTTCGAAGTCGAAGAAGGCTATAAGAGAA---GTAACCCTAAAACACCCACACATGAAG------------AACAATTTTCGTAAG--------------------------A---GAGTCGGTCACA---TCTGAATGTGAAA--------------------------------------------------------------------GAAAAG------------------------------------------------------------------------GAGGAAACTCAA------------------------AATTTTGTT------TTTGATCC-GTTGCAAGAGAGATGAGGAACAAGGCTAGGGCGAAAGCGAGAGAAAGAGCAAGA Pterocephalus_strictus_3B ------------------------------------------------------------------------GCTCGAAGATTCTTCGATCTGCAAGATATGTTAGGGTTTGACAAAGCTAGCAAAACCATTGAATGGCTTTTGGCTAAATCAAAAGGGGCGATCAAGGAA---CTCACCAGA------AACTTACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAGTACCACC-GT---ATTGGAGAAGGCAATTGTGTG------TTCTTT---GGTTCGTCCAAAGGCGATAAGAACAAAAGG------------------------------GACATG------GGAATAATGGCAGTGAAGTTGTCTCGGGCAAAAGCAAGAGAAAGAGCAAGA------------ Pycnocomon_rutifolium_1B ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}{AG}A{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCGAGCAAAACGGTTGATTGGTTACTCGATCAATCAAGATCTGC-ATTGAAGATCTCAATAAATTAGCT------------ATTAGTTCG---AACCACATCTCAAGTGTAGAAGATGCAGCTAAGCAGTTAACTAGAACAACATCATCGGCT---TCCGAGTGTGAAGTT---------TTGTCGGGTACTGATCATGAGCCA---AGACCTGAGTTGGCC------------------------------------GGTAAGGGTAAAGGAATAATTTTG---GATGCAAGTATAATC------AAGGAT---AAGAAG---AGAAAGGGA---------AAAGTT---AGAAGG---GTTGCATTTGACTCTAATGCTAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Pycnocomon_rutifolium_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGATAAGGCAAGTCAAACACTTGACTGGCTACTCAACAAGTCCAAAGCTGCCATTAAAGATTTGGTCAAGTCCAAGCTG---------------------------AGTAGTAGTAAT---GCCAAGTGT---AC-TTGACT---ATT---------------TACGAGAGCGATGATGAT---GTGAGTCCTCTTGAGACGCATAATGTCGTTGA-GACCTTGAG---------------------------------------GAGGATGGG---------------AAA------------------ATAATGGCAGAGAAAAGGG-G---AAATCAAAGCAGAAGGCT------GATAAA---TCACCAGTTGATCTTGCAGCTAAAGAATCTAGGGCTAAAGCTCGAGCTCGAGCAAGA------------ Pycnocomon_rutifolium_2Ba ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGTTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAAT---ACTCAAAGCAAT---AAA------------------------------------------------------------------------TGTGATAGTACTAATAGTAAAAATAATAAT---AAAATTGCTCAT------------------------------------------------------------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGACTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pycnocomon_rutifolium_2Bb_1 ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}G{AG}TCT-CA-GATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACCAAATCCATT---AATAATATTAAT---ACTAAT---TATTAT---AATCCCACTGGATGTTTGTATGAAATGGTG---------------------TATAATACTAATAATAATAAT---AATGGTAGT------------------------------------------------------------------ATTGAAAAAATTAGT------------------------------------------------------------AGAAATGCA------TTTGGTATGAGTTCTAGAGAATCTAGAGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Pycnocomon_rutifolium_2Bb_2 ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATCTATT---AATAATATTAATATGATTAATACTTATAAT---AATCCCACTGGTTGCTTGTATGAAATGGTG---------------------TATAATACTAATAATAATGGT------------------------------------------------------------------------------ATTGAAAAAATTAAT------------------------------------------------------------AGAGATGCA------TTTGGTACAAGTTCTAAAGAATCTAGGGC{AG}AATGC{AG}AG{AG}GCAAGAGCAAG{AG}------------ Pycnocomon_rutifolium_3A -----------------------------------------------------------------------TGCGCGTAATTTTTTTGGCCTCCAAGATATGTTAGGGTTTGATAAAGCGAGCAAAACCATTGAGTGGTTGTTTTCGAAGTCGAAGAAGGCTATAAGAGAA---GTAACCCTAAAACACCCACACATGAAG------------AACAATTTTCGTAAGATA---------------------AAA---GAGTCGGTCACA---TCTGAATGTGAAATG---------ATC---------------------------------------------------GACGAAAAG------------------------------------------------------------------------GAGGAAACTCAA------------------------AGTTTTGTT------TTTGATCCGGTTGCAAGAGAGATGAGGAACAAGGCTAGGGCAAAGGCAAGAGAAAGAGCAAA- Scabiosa_angustiloba_1Ba ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCGAGCAAAACGGTTGATTGGTTACTCGATCAAT-AAGATCTGC-ATTGAAGATCTCAATAAATTAGCT------------ATTAGTTCG---AACCACATCTCAAGTGTAGAAGATGCAGCTAAGCAGTTAACTAGAACAACATCATCGGCT---TCCGAGTGTGAAGTT---------TTGTCGGGTACTGATCATGAGCCA---AGACCTGAGTTGGCC------------------------------------GGTAAGGGTAAAGGAATAATTTTG---GATGCAGGTATAATC------AAGGAT---AAGAAG---AGAAAGGGA---------AAAGTT---AGAAGG---GTTGCATTTGACTCTAATGCTAGGGAGTT{AG}A{AG}{AG}GC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Scabiosa_angustiloba_1Bb ------------------------------------------------------------------------------------------------------CTTGGATTCGAAAAGGCAAGCAAAACTGTTGATTGGTTACTCGATCAATCAAGATCTGCCATTGAGGATCTCACAAAATTAGCC------------CTTAATTCG---ATCCACGACTCAAGTATATTAGGTGCAGCTAAGGACTTAACTAGAACAACATCTTCGGCT---TCCGAGTGTGAAGTT---------TTGTCTGGTACTGATCATGAGCCA---AAGCCTGAGTTGGCC------------------------------------AGTAAGGGTAAAGGGAAAAGTTTG---GGTGCAGGCAGC---------AAGGAT---AAGAAG---AGAAAGGGA---------ATAG-T---ACAAGG---GCTGCATTTGACTCTAATGCCAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Scabiosa_angustiloba_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGATAAGGCAAGTCAAACACTTGACTGGCTA-TCAACAAGTCCAAAGCTGCCATTAAAGATTTGGTCAAGTCCAAACTATGC------TGTAGTAGTACT------AGTAGTAGTAATAT-GCTAAGTGTCGTACGTTGAC-ACCATT---------------TACGAGAGCGATGATGAT---GTGGATCCTCTTGAGACGCATAATGTTGTT---GACCTTGAG---------------------------------------GAGGATGGG---------------AAAATT---------------ATCACAAAA---AGAAGGGTG---AGATCAAAGCAGAAGGCT------GATAAA---TCACCACATGATCTTGCAGCTAAGGAGTCTAGGTCTAAAGCCCGAGCTCGAGCAAG------------- Scabiosa_angustiloba_2Ba ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGTTCTAAGGA{CT}CCAATTAATGAGCTGATCAACATGAAGATGAAT---ACTCAAAGCAAT---------------------------------------------------------------------------AAATGTGATAGTACTAATAGTAAAAATAATAAT---------------------------------------------------------AAAATTGCT------------CATGAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGACTCGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Scabiosa_angustiloba_2Bb ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATCTATT---AATAATATT---------AATACTTAT------AATCCCACTGGATGTTTGTATGAAATGGTG---------------------TATAATACTAATAATAATAAT------------------------------------------------------------ATTGGT------------ATTGAAAAAATTAGT------------------------------------------------------------AGAGATGCA------TTTGGTATGAGTTCTAGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GCAAGAGCAAGA------------ Scabiosa_angustiloba_3A ------------------------------------------------------------------------GCGCGTAATTTTTTTGGCCTCCAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCATTGAGTGGTTGTTTTCGAAGTCGAAGAAGGCTATAAGAGAA---GTAACCCTAAAACACCCACACATGAAG------------AACAATTTTCGTAAGATA---------------------AAA---GAGTCGGTCACA---TCTGAATGTGAAATG---------ATC---------------------------------------------------GACGAAAAG------------------------------------------------------------------------GAGGAAACTCAA------------------------AGTTTTGTT------TTTGATCCGGTTGCAAGAGAGATGAGGAACAAGGCTAGGGCGAAAGCGAGAGAAAGAGCA--- Scabiosa_columbaria_1 AAAGACCGGCACAGCAAGATCAACACAGCCCATGGCCCGAGAGACAGAAGAATGAGACTGTCTCTTGATGTTGCGCGTAAGTTCTTTAGTCTCCAAGACATGCTTGGATTCGAAAAGGCAAGCAAAACTGTTGATTGGTTACTAGATCAATCAAGATCTGCCATTGAGGATCTCACTAAATTAGCC------------CTTAGCTCG---AACCACAGCTCAAGTGTAGTAGGTGCAGTTAAGAACTTAACTAGAACAACATCTTCGGCT---TCCGAGTGTGAAGTT---------TTGTCTGGTACTGATTATGAGCCA---AAGCCTGAGTTGGCC------------------------------------GGTAAGGTTAAAGGGAAAAGTTTG---GGTGCAGGCAGC---------AAGGAT---AAGAAG---AGAAAAGGA---------ATAGTT---ACAAGG---GTTGCATTTGATTCTAATGCAAGGGAGTCGAGGGCGAAGGCGAGAGCGA-------------------- Sixalix_atropurpurea_1Ba ------------------------------------------------------------------------GCGCG-AG-TT{CT}TT{CT}GA{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCGAGCAAAACGGTTGATTGGTTACTCGATCAATCAAGATCTGCCATTGAAGATCTCAATAAATTAGCT------------ATTAGTTCG---AACCACATCTCAAGTGTAGAAGATGCAGCTAAGCAGTTAACTAGAACAACATCATCGGCT---TCCGAGTGTGAAGTT---------TTGTCGGGTACTGATCATGAGCCA---AGACCTGAGTTGGCC------------------------------------GGTAAGGGTAAAGGAATAATTTTG---GATGCAGGTATAATC------AAGGAT---AAGAAG---AGAAAGGGA---------AAAGTT---AGAAGG---GTTGCATTTGACTCTAATGCTAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_1Bb ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GA{CT}CTCCA{AG}GACATGCTTGGATTCGAAAAGGCTAGCAAAACGGTTGATTGGTTACTCGATCAATCAAGATCCGCCATTGAGGATCTCACAAAATTAGCC------------CTTAATTCG---AACCACAACTCGAGTGTA---------------------GCTAGAACAACATCTTCAGCT---TCTGAGTGTGAAGTT---------TTGTCTGGTACTGATCATGAGGCA---AAGGCTGAGTTA---------------------------------------GGTAAGGGTAAAGGGAAAATTTTG---TGTGCAGGC------------AAAGAT---AAGAAG---AGAAAGGGA---------ATGGTT---ACAAGG---GTTGCATTTGACTCTAATGCCAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_1Bc ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCATGACATGCTTGGATTCGAAAAGGCAAGCAAAACTGTTGATTGGTTACTCGATCAATCAAGATCTGCCATTGAGGATCTCACAAAATTAGCC------------CTTAATTCG---ATCCACGACTCAAGTATATTAGGTGCAGCTAAGGACTTAACTAGAACAACATCTTCGGCT---TCCGAGTGTGAAGTT---------TTGTCTGGTACTGATCATGAGCCA---AAGCCTGAGTTGGCC------------------------------------AGTAAGGGTAAAGGGAAAAGTTTG---GGTGCAGGCAGC---------AAGGAT---AAGAAG---AGAAAGGGA---------ATAGTT---ACAAGG---GCTGCATTTGACTCTAATGCCAGGGAGTT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_1Bd ------------------------------------------------------------------------GCGCG-AA-TT{CT}TT{CT}GG{CT}CTCCA{AG}GACATGCTTGGATTCGAGAAGGCAAGCAAAACTGTTGATTGGTTACTCGATCAATCAAGATCTGGCATTGAGGATCTCACTAAATTAGCC------------CTAAAATCG---AACCACAGCTCAAGTGTAGTAGACGCAGTGAAGCACTTAACTAGAACAACATCTTCGGCT---TCCGAGTGTGAAGTT---------TTGTCTGGTACTGATCATGAGCCA---AAGCCTGAGTTGGCC------------------------------------AGTAAGGCTAAAGGGAAAAGTTGG---GGTGCAGGCAGC---------AAGGAT---AAGAAG---AGAAAGGGA---------ATAGCT---ACAAGG---GTTGCATTTGACTCTAGTGCCAGGGAGAT{AG}AGGGC{AG}AAAGC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_2A ------------------------------------------------------------------------GCGCG-AAATT{CT}TT{CT}GATCTCCAAGACACATTAGGGTTTGACAAGGCAAGTCAAACACTTGACTGGCTACTCAACAAGTCCAAAGCTGCCATTAAAGATTTGGTCAAGTCCAAACTATGC------TGTAGTAGTCCT------AGTAGTAGTAATATCGCTAAGTGTCGAACGTTGACTACCATT---------------TACGAGAGCGATGATGAT---GTGGATCCTCTTGAGACACATAATGTT------GACCTTGAG---------------------------------------GAGGATGGG---------------AAAAAT---------------ATTACAGAG---AGAAGGGTG---AAATCAAAGCAGAAGGCT------GATAAA---TCACCGGTTGATCTTGCGGCTAAAGAGTCTAGGGCTAAAGCTCGAGCTCGAGCGAGA------------ Sixalix_atropurpurea_2Ba_1 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGCTAGGGTTTGATAAAGCAAGCAAAACCCTAGATTGGCTTTT{CT}GCTTGCTCCAAGGACTCAATTAATGAGCTGATCAACATGAAGAAGATG---AGTTATTATAAT---------------------------------------------------------------------------------------AGTAATAGTAATAATAATAGT---------------------------------------------------------ACATTTGCT---------------GAGAAAAATTGT------------------------------------------------------------AGGGATGGA------TTCGGTACGAGTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_2Ba_2 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATTTGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTT{CT}ACTTGCTCTAAGGACTCAATTAATGAGCTGATCAACATGAAGATGAGT---GCTCAATGCATT------------------------------------------------------------------------------------------AAT{AG}GT------------------------------------------------------------GATTGTAATAAGGTTGCT---------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCT{AC}GAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_2Ba_3 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTCATCAACATGAAGAAGATG---ACTACTGTTAAT------------------------------------------------------------------------------TGTGAT---GGTAATAGTATTAAT------------------------------------------------------GATAAAGATAAGGTTGCT---------------CAGAAGATTACT------------------------------------------------------------------GGA------TTCGATTCCACTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_2Ba_4 ------------------------------------------------------------------------GCGCG-A{AG}{AG}TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTAGATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTCATCAACATGAAGAAGATG---ACTACTGTTAAT------------------------------------------------------------------------------TGTGAT---GGTAATAGTATTAAT------------------------------------------------------GATAAAGATAAGGTTGCT---------------CAGAAGATTTTTAGG---------------------------------------------------------GGTAC{CT}GGA------TTCGATTCCACTTCTCGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GAAAGAGCAAGA------------ Sixalix_atropurpurea_2Bb ------------------------------------------------------------------------GCGCG-A{AG}-TT{CT}TT{CT}GATCT-CAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCCTTGACTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACCAAATCCATT---AATAATATTAAT---ACTAATTATTAT------AATCCCACTGGATGTTTGTATGAAATGGTG---------------------TATAATACTAATAATAATAAT---------------------------------------------------------AATGGTAGT------------ATTGAAAAAATTAGT------------------------------------------------------------AGAAATGCA------TTTGGTATGAGTTCTAGAGAATCTAGGGC{AG}AA{AG}GC{AG}AG{AG}GCAAGAGCAAG{AG}------------ Sixalix_atropurpurea_3A ------------------------------------------------------------------------GCACGGAATTTATT{CT}GGTCTCCAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCATTGAGTGGTTGTTTTCGAAGTCGAAGAAGGCTATAAGAGAA---GTAACCCTAAAACACCCACACATGAAG------------AACAATTTTCGTAAGATA---------------------AAA---GAGTCGGTCACA---TCTGAATGTGAAATG---------ATC---------------------------------------------------GACGAAAAG------------------------------------------------------------------------GAGGAAACTCAA------------------------AGTTTTGTT------TTTGATCCGGTTGCAAGAGAGATGAGGAACAAGGCTAGGGCGAA{AG}GCGAGAGAAAGAGCAAGA Sixalix_atropurpurea_3B ------------------------------------------------------------------------GCACGTAGGTTCTTTGATCTACAAGATATGTTAGGCTTTGACAAAGCTAGCAAAACCATCGAGTGGCTTTTGGCTAAATCAAAAGGGGCGATCATGGAA---CTCACCAGA------AACTTACCT---------------------------------------------------------------------------------------------------------------------------------------------------------------ACC-TGCGTACC------------------------------------AGTACTAGTATCGGAGAAGGCGAAAAGAACAAAAGG------------------------------GACATG------GGAATAATGGCAGTGAAGTTGTCTCGGGATAAGGCAAGGGCAAAAGCAAGA------------ Sixalix_farinosa_2Ba ---------------------------------------------------------------------------CGTAAATTTTTCGATCTTCAAGATATGTTAGGGTTTGATAAAGCAAGCCAAACCCTATATTGGCTTTTCACTTGCTCTAAGGACTCAATTAATGAGCTGATCAATATGAAGATGAGT---ACTCAGTGTATT------------------------------------------------------------------------------------------AATAGTAAAAATAATAAT---------------------------------------------------------AAAATTGCT---------------GAGAAGATTTGT------------------------------------------------------------AGGGATGGA------TTCGGTTCGAGTTCTCGAGAATCTAGGGCAAAGGCAAGAGCAAGA------------------ Sixalix_farinosa_2Bb ---------------------------------------------------------------------------------TTCTTCGATCTTCAAGATATGTTAGGGTTTGACAAAGCAAGCAAAACCCTTGATTGGCTTTTCACTAGCTCAAAGGACTCAATTAAAGAGTTGGTTAATATGAAGATGAAGATGACTAAATCTGTT---AATAATATTAAT---ACTAATACTTAT------AATCCCACTGGATGCTTGTATGAAATGGTG---------------------TATAATACTAATAATAATTAT---------------------------------------------------------AATAATGGT------------ATTGAAAAAATTAGT------------------------------------------------------------AGAGATGCA------TTTGGTATAAGTTC------------------------------------------------- Symphoricarpos_occidentalis_1 AAAGACCGCCACAGCAAGATCAACACCGCCCACGGCCCTAGGGACAGGAGAATGAGACTCTCTCTTGATGTTGCTCGCAAGTTCTTTGGCCTCCAAGACATGCTCGGCTTCGACAAGGCCAGTAAAACCGTCGAGTGGTTGCTAACTAAGTCAAAATCCGCTATCAAAGACCTCACCAGAGCC---------------CTTAACTCC---AACCACAGTTCCAGTGTT---CGTGCC---------------AATAGCGTGTCTTCAACT---TCTAAGTGTGAGGTC---------TTGTCTGGTACTGAG---GACGCG------CGCGTGTTAAATGAG---GAGGATATACGCGTATCC---AACACTAGTACCAAGGGGAAAGGCACCGTC------GGG------------------AAGGCG---AAGAAG---AGTAAAGCG------------GTGACTAGGAGA---ATCGCATTTGATGCTAACGCGAGGGAGTCGAGGGCGAAAGCGAGGG----------------------- Symphoricarpos_occidentalis_3A AAAGATCGGCACAGCAAAATCTACACGGCACAAGGCTTGAGGGACCGGAGGATGAGATTGTCCCTTAAAATTGCTCGCAAGTTCTTTGATCTACAAGACATGTTAGGGTTCGATAAAGCAAGCAAAACCATCGAGTGGCTATTCTCCAAGTCGAAGAAGGCCATCAAAGAA---GTAAACCTAAATCACCCTAAAATGAAG------------AATACT------------AGAGAG---------------AAGAATGAGTCAATTGTG---TTTGAATGTGAAGTA---------GAATCCGCGATCGAAAATGTT---AAT---------------------------GGAGAGAGATCA---------------------------------------------------------------GAAAGGGGAAAAGCTCAA------------------------AAAGTAGCT------TGTGGTCATCTGGCACGAGAGTCGAGGGCGAAGGCGAGAGCGAG------------------- Symphoricarpos_occidentalis_3B AAAGATCGGCACAGCAAAATATTTACTTCTCAGGGTTTGAGAGCTAGGAGGATGAGATTACCCCTTCAAATCGCTCGAAGGTTCTTCGATCTACAAGACCTATTAGGCTTCGACAAAGCTAGCAAAACCATCGAGTGGCTTTTCGCCAAATCAAGAAAGGCCATCAAAGAA---CTCACCAAG------AACATCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------AACATGAACGAA---------AAAGGCAAATGTGAG------TCTTTTTCCGATCCATTTGAAGGCGAAAAGAATAAAAGA------------------------------GAATTG------GGA---AAGGCG---AGGGAGTCGAGGGCGAAAGCGAGAGCGAG------------------- Symphoricarpos_orbiculatus_1 AAAGACCGACACAGCAAGATCAACACCGCCCACGGCCCTAGGGACAGGAGAATGAGACTCTCTCTTGATGTTGCTCGCAAGTTCTTCGGCCTCCAAGACATGCTCGGCTTCGACAAGGCCAGTAAAACCGTCGAGT-GTTGCTAACTAAGTCAAAATCCGCTATCAAAGACCTCACCAGAGCC---------------CTTAACTCC---AACCACAGTTCCAGTGTT---GGTGCC---------------AATAGCGCGTCTTCGACT---TCTGAGTGTGAGGTC---------TTGTCTGGTACTGAG---GACGCG------CGCGTGTTAAACGAG---GAGCATACACGCGTGTTC---AACACTAGTACCAAGGGGAAAAGCACCGTC------GGG------------------AAGGCG---AAGAAG---AGTAAAGCG------------GTGACTAGGAGA---ATCGCATTTGATGCTAACGCGAGGGAGACGAGGGCGAAAGCGAG------------------------- Symphoricarpos_orbiculatus_2A AAAGA{CT}CGGCACAGCAAAATTTACACTGCCCAAGGACCTCGTGACCGGAGGGTAAGATTGTCAATTGAAATAGCCCGAAAGTTATTTGATCTCCACGACATGTTGGGGTTCGACAAGGCGAGCGGAACACTTGATTGGCTACTCAACAAATCCCAAACCGCCATAAAAGATTTGGTACAGTCCAAGCTCAGC------TGT---ACC---------AGCAGTAGTGATGCAAGG------TGTAGTTTGAGTTCCATT---------------TACGAATGCGAATCA------------------GACAAGCACAAA------------TTAGACCCG------------------------------------GAGAATGGG------------------------------------ATTGAAGGA---AAAAAGTTGAGAAATCCA---------ATA------GATAAATGTTCAGTTATTGATCTTGCGGCAAGAGAG{AT}CGAGGGCGAAAGCGAGAGCGAG------------------- Triosteum_himalayanum_1 AAAGACCGCCACAGCAAGATCAACACCGCCCACGGCCCTAGGGACAGGAGAATGAGACTCTCTCTTGATGTTGCTCGTAAGTTCTTCGGCCTCCAAGACATGCTCGGCTTCGACAAGGCAAGTAAAACCGTCGAGTGGTTGCTAACCAAGTCAAAATCCGCTATCAAAGACCTCACCAGAGGC---------------CTTAACTCC---AACCACAGTTCCAGTGTT---GGTGCC---------------AATAGTGCGTCTTCAACT---TCTGAGTGCGAGGTC---------TTGTCTGGTATTGAG---GACACG------CGCGTGTTAAACGAG---GATACA---CTCGTGTCC---AACACTAGTACTAAGGGGAAAGGCACCGTC------GGG------------------AAGGCC---AAGAAG---GGTAAAGGG------------GTCACTAGGAGA---ATCGCATTTGATGCTAACGCGAGGGAGTCGAGGGCGAAGGCGAGGGCGAG------------------- Triosteum_himalayanum_2A AAAGACCGACACAGCAAAATTTACACGGCCCAAGGAGCTCGTGACCGGAGGGTAAGATTGTCAATTGAAATAGCCCGAAAGTTCTTTGATCTCCAAGACATGTTGGGTTTCGACAAGGCGAGCCGAACACTTGATTGGCTACTCAACAAATCCCGAACCGCCATAAAAGATTTGGTACAGTCGAAGCTCGGC------TGT---ACC---------AGCAGTAGTGATGCAAGG------TGTTCTTTGAGTTCCATT---------------TACGAATGCGAATCA------------------GACAAGCACAAA------------TTAGACCCG------------------------------------GAGAATGGGGAA---------------------ATCGCGAGTGGGATTAAAGAA---AAAAAGTTGAGAAAGCCA---------GCG------GATAAATCTTCAGTTATTGATCTTGCCGCTAGAGAGTCGAGGGCGAAGGCGAGGGCGAG------------------- Triosteum_himalayanum_2B AAAGATCGGCACAGCAAAATATATACCGCACAAGGTCCGAGGGACCGGAGGGTGAGATTGTCCATGGAGATAGCCCGTAAATTCTTTGATCTTCAAGACTTGCTGGGTTTTGATAAAGCGAGTAAAACCCTTGACTGGCTGCTGACCCACTCTAAGGCGGCGATCAAAGAGTTGGTCCAGATGAAAATCAAC------TGCACTACTGATCAG---GGGGGCGGC------------AGT------------------------GAAATGATATGTGGA---------AATAATTATTGTAACAAGAACGAGACGAGTAGT------------------------------------------------------GTTGTTGGG---------AACGAGAAG------------------------------------------------------------------AGGGATGCG------TTTGATATTAGTTCGAGAGAGTCGAGGGCGAAAGCGAGGGCGAG------------------- Triosteum_himalayanum_3A AAAGA{CT}CG{AC}CACAGCAAAATCTACACGGCACAAGGCTTGAGGGACCGGAGGATGAGATTGTCCCTTCAAATTGCGCGCAAGTTCTTTGATCTACAAGACATGTTAGGGTTCGATAAAG{CT}AAGCAAAACCATCGAGTGGCTATTCTCCAAGTCGAAGAAGGCCATCAAAGAA---GTAACCCTAAAACACCCTAAAATGAAG------------AATACT------------ACAGAG---------------AAGAATGAGTCAATTGTG---TCTGAATGTGAAGTA---------GAATCCGCGATCGAAAATGTT---AAT---------------------------GGAGAGAGATCA---------------------------------------------------------------GAAAGGGGAAAAGCTCAA------------------------AAAGTAGCT------TATGGTCATCTAGCACGAGAGTCGAGGGCGAA{AG}GCGAG{AG}GCGAG------------------- Triplostegia_glandulifera_1 AAAGATCGGCACAGCAAGATCAACACGGCCCAAGGCCCTAGGGACCGGAGAATGAGACTATCCCTTGATGTTGCCCGTAAGTTCTTCAATCTCCAAGACATTCTCGGCTTCGAAAAGGCCAGCAAAACCGTCGAGTGGTTACTCACTCAATCAAAATCCACCATCGAGGACCTCACTAGAGCCATAAGAGGC------CTTAACTCG---AACCATAGCTCAAGTGTG---GGTGCA------------GCCAATAGCGTGTCTTCTACTACTTCCGAGTGTGAGGTC---------TTGTCTGGTACAGAT---GAGCCG---AGGTTTCAGTTGGCTAAG---------------------------------CCTAAAGGAAAAGGATCGAGTGGTGCG---------------------AAGGGT---AAGAAG---AGAAAGGGG---------ATAGTT---AGAAGA---GTTGCATTTGACTCTACCGCTAAGGAGTCGAGGGCGAAAGCGA-------------------------- Triplostegia_glandulifera_2B ------------------------------------------------------------------------------------------------GACATGTTAGGTTTTGACAAAGCAAGCAAAACCCTTGACTGGCTTTTCACCAATTCCAAGGAGTCGATTAAAGAGCTGGTCCACACGAAGATGAAGATGAGCAAGTACAATAATACTCATAATAATAAT---------------------ACTACAGGACGTTTGTTCGAGATGGTG---------------------TGTAACAGTAACAATGGGAAC---------------------------------------------------------------------------------GATAAGATT---------------------------------------------------------------AGGGATGCA------TTTGATATGAGTTCAAGAGAGTCTAGGGCAAAAGCGAGGGAAAGAGC---------------- Triplostegia_glandulifera_3B ------------------------------------------------------------------------------------------------GACATGTTAGGCTTCGACAAAGCGAGCAAAACCATTGAGTGGCTTTTGGTCAAATCCAAAGGTGCAATCAAGGAA---CTTACAAAA------AACATACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------AGCAGAGTGAATGAA---------AATGGCGGTAGTGGA------TCCTTTTCGGATTCGTCTGAAGGTGAAAAGAGCAAAAGA------------------------------GAATTG------GGA---AAGGCA---AGGGAGTCAAGGGCGAAAGCGAGGGAAAGAGCAA-------------- Valerianella_dentata_1 ------------------------------------------------------------------------------------------------GACCTTCTCGGCTTTGAAAAGGCTAGCAAAACAGTAGCGTGGTTACTCTCTCAGTCCGAATCTGCCATCAATGATCTCTCTAGATCAGCT------------GTTGACATC---AACTCATCGAGTAACAATTTAGGTGTT------------GTCAACAGCGCCTCTTCCACT---TCAGAGTGTGAGGTC---------TTGTCAACCATCAAA---GAGCCAGCTAGGGTTGAATTGGCTAAG---------------------------------CCGAAATCAGTG---------------AAAGCAGCTATCCCG---------GAA---AAGAAA---AGAAAGGGTGCTTATAATATTGTT---AGGAGA---GCTGCATTTAACTCAACCGCAAGGGAATTGAGGGCAAAAGCGAGAGAAAGAGCAA-------------- Valerianella_dentata_2B ------------------------------------------------------------------------------------------------GATATGTTGGGGTTCGACAAAGCGAGTAAAACCCTTGACTGGCTGTTGACCAAATCTAAAGAATCAATTAAAGAGCTGGTGAACATGAAGATGAAGGTTAAC---------------------AGTAGTAATAAT---------------GGAAGTGGATGTTTGTTTGAAATGGTG---------------------TATAATAATAATGGTAGAAATAAT------------------------------------------------------------------------------GACAAGGTAATG------------------------------------------------------------AGGGATGCA------TTTGATTCGAGTTCAAGAGAATCTAGGGCAAAAGCAAGAGAAAGAGCAA-------------- Valerianella_dentata_3B ------------------------------------------------------------------------------------------------GACATGTTGGGCTATGATAAAGCTAGCAAAACTATTGAGTGGCTAATGTCTAAATCCACAGGGGCAATCAGGGAA---ATCACTAAA------AACATATCC---------------------------------------------------------------------------------------------------------------------------------------------------------------ACTACTAGTAAC---------ACCATCCAGAAAGGCCAA---------------GATTTTTTAGATTTATTTGAAGAT------------------------------------GACCAT------GAAGTTAAAAAAAGAAGACTTGACAGGGCAAAAGCAAGAGAAAGAGCAA-------------- Weigela_hortensis_1 AAAGACCG{CG}CACAGCAAGATCAACACCGCACACGGCCCTAGGGACCGCAGAATGAGGCTCTCCCTCGATGTGGCACGCAAGTTCTTCGGCCTCCAAGACATGCTTTGCTTCGACAAGGCAAGCAAGACGGTCGAGTGGTTACTAACTAAGTCGAAATCCGCC{AG}TCAAGGACCTCACTAGAGGCGGCGGA---------CTTAACTCC---AACCACAGCTCCAGTATGGGTGGTGCC---------------AATAGCGCATCTTCCACT---TGCG{AG}GTGCGAGGTCGAG---GTCCTGTCTGGGATTGAG---GAGCCAGGTGGTACTGTC---GACGAAAACGATCACACACGC------------------ACCAAGGGGAAA---------------GGCTCGGGCGCAAAGGAT---AAGGAG---AAGAAG---AGTAAGGGG---------------GCTAGGAGG---ATTGCATTTGATCCGATCACGAGGGAG{AT}CGAGGGCGAAGGCGAGGGCGAG------------------- Weigela_hortensis_2A AAAGATCGGCACAGCAAAATATACACGGCCCAAGGACCCCGAGACCGGAGGGTAAGATTGTCCATTGAAATCGCACGAAAGTTCTTTGATCTTCAAGACATGCTAGGGTTTGACAAGGCGAGTAGAACACTCGACTGGCTCCTCAACAAGTCAAAAACTGCCATCAAAGATTTAGTCCAGTCGAAGCTCGGC------TGC---ACT---------AGTGGTGGTAAT---GCCACTAGTACTGCCTTGACTTCTATT---------------TACGAGTGCGAAGAAATG------AAATCA---AAGACCTACAAA------------TTAGTCCCC------------------------------------AATAATGGGGAA---------------------ATCGCGTGTGGGATTAAAGAA---AAAAAGACGAGGAAGCAG---------ACA------GATAAA---TCTGCCATTGATCTTGTTGCTAGAGAGTCGAGGGCGAAAGCGA-------------------------- Weigela_hortensis_2B AAAGATCGGCACAGCAAAATATTCACGGCACACGGTCCTAGGGATCGGAGAGTAAGGTTATCCATGGAGATAGCACGGAAATTCTTCGACCTCCAAGACCTGCTAGGTTTTGACAAAGCGAGTAAAACCCTTGACTGGCTGCTGACCAACTCCAAGGCCGCGATTATAGAGTTGGTCCAGATGAAGATCAGC------TGT---ACTACT------GGCTCTCAG------------------------------------TGCGATATGGTATGTGAA------------AATTACAAT---------------------------------------------------------------------GGGTTGCCTGTCGGG---------AACGAGAAGATC---------------------------------------------------------------AGGGATGCA------TTTGATATTAGTTCGAGAGAGTCGAGGGCGAAGGCGAGAGCGAG------------------- Weigela_hortensis_3A AAAGATCGGCACAGCAAAATCTACACCGCGCAAGGCCTGAGGGACCGGAGGATGAGATTATCGGTTCAAATTGCTCGCAAGTTCTTTGATCTACAAGATATGTTAGGGTTTGATAAAGCAAGCAAAACCATCGAGTGGCTATTCACCAAGTCGAAGAAGGCGATCAAGGAA---TTAACCCTAAACCACCAACAAATGAAG------------AACAGTCACCGCAGT---AGAGAG---------------AAGAGCGAGTCCTTTGTG---TCCGAGCGTGAAGTA---------GAATTCGTTACCGAGAATGTT---AAT---------------------------------------------------------------------------------------------------GGTGAAAGGGGAAAAGCTCAA------------------------AAAGTAGCA------AATGATCCATTAGCACGAGAGTCGAGGGCGAA{AG}GCGAGGGCGAG------------------- ; END; [ The following blocks are output data for analysis step 17821 ] BEGIN TREES; TITLE Caprifoliaceae_CYC_MrBayes_Cons; LINK TAXA = TaxaForAnalysisStep17821; TREE Caprifoliaceae_CYC_MrBayes_Cons = [&R] (((Kolkwitzia_amabilis_1,Abelia_x_grandiflora_1,Dipelta_floribunda_1,Linnaea_borealis_1,((Patrinia_triloba_1,(Valerianella_dentata_1,Fedia_cornucopiae_1)100)100,((Bassecoia_bretschneideri_1,Triplostegia_glandulifera_1)100,((Cephalaria_hirsuta_1,(Dipsacus_pilosus_1,Dipsacus_inermis_1)99.988)100,((Knautia_calycina_1,Knautia_macedonica_1)100,(Sixalix_atropurpurea_1Bd,(Scabiosa_columbaria_1,Pterocephalus_strictus_1Bb)99.988,(Scabiosa_angustiloba_1Bb,Sixalix_atropurpurea_1Bc)100,((Scabiosa_angustiloba_1Ba,Sixalix_atropurpurea_1Ba,Cephalaria_hirsuta_1B,Pycnocomon_rutifolium_1B)100,((Sixalix_atropurpurea_1Bb,Pterocephalus_strictus_1Ba)99.95,(Cephalaria_humilis_1B,Lomelosia_crenata_1B)70.566)100)66.117)100)93.388)100)70.691)99.163)99.475,((Diervilla_sessilifolia_1,Weigela_hortensis_1)100,(Heptacodium_miconioides_1,(Triosteum_himalayanum_1,Lonicera_heteroloba_1,(Leycesteria_formosa_1a,Leycesteria_sp_1b)100,(Symphoricarpos_occidentalis_1,Symphoricarpos_orbiculatus_1)100)99.813)98.438)98.65),((((Heptacodium_miconioides_3A,((Diervilla_sessilifolia_3A,Weigela_hortensis_3A)100,(Triosteum_himalayanum_3A,(Lonicera_reticulata_3A,Symphoricarpos_occidentalis_3A,(Lonicera_heteroloba_3Aa,Lonicera_heteroloba_3Ab)100)90.001)99.875)75.203)72.266,((Dipelta_floribunda_3A,Linnaea_borealis_3A,(Kolkwitzia_amabilis_3A,(Abelia_x_grandiflora_3Aa,Abelia_x_grandiflora_3Ab)87.439)95.051)99.075,(Cryptothladia_chinensis_3A,((Fedia_cornucopiae_3A,Centranthus_ruber_3A)100,(Knautia_macedonica_3A,(Scabiosa_angustiloba_3A,Sixalix_atropurpurea_3A,Pycnocomon_rutifolium_3A,Pterocephalus_strictus_3A)97.413)100)97.325)54.018)91.651)98.8,(Heptacodium_miconioides_3B,(Lonicera_reticulata_3B,Symphoricarpos_occidentalis_3B)100,(Triplostegia_glandulifera_3B,Patrinia_triloba_3B,(Kolkwitzia_amabilis_3B,Dipelta_floribunda_3B)95.938,(Centranthus_ruber_3B,(Valerianella_dentata_3B,Fedia_cornucopiae_3B)100)100,((Morina_longifolia_3Bb,(Cryptothladia_kokonorica_3Ba,Cryptothladia_chinensis_3Ba)98.025)100,(Morina_longifolia_3Ba,(Cryptothladia_kokonorica_3Bb,Cryptothladia_chinensis_3Bb)97.338)93.388)98.463,(Bassecoia_bretschneideri_3B,(Dipsacus_pilosus_3B,Pseudoscabiosa_limonifolia_3B)99.563,(Knautia_calycina_3Bb,Knautia_macedonica_3Bb)100,(Sixalix_atropurpurea_3B,(Pterocephalus_strictus_3B,Knautia_calycina_3Ba)86.877)100)100)80.19)100)100,((((Diervilla_sessilifolia_2A,Weigela_hortensis_2A)99.988,(Triosteum_himalayanum_2A,(Leycesteria_formosa_2A,(Symphoricarpos_orbiculatus_2A,(Lonicera_reticulata_2A,Lonicera_heteroloba_2A)56.855)95.351)86.714)100)76.903,((Cryptothladia_kokonorica_2A,(Centranthus_ruber_2A,Fedia_cornucopiae_2A)100)92.476,(Patrinia_triloba_2A,(Kolkwitzia_amabilis_2A,Dipelta_floribunda_2A)100,(((Lomelosia_crenata_2A,Pycnocomon_rutifolium_2A)100,(Pterocephalus_strictus_2A,(Sixalix_atropurpurea_2A,Scabiosa_angustiloba_2A)96.963)98.1)100,(Bassecoia_bretschneideri_2A,((Knautia_macedonica_2A,Knautia_calycina_2A)69.641,(Dipsacus_inermis_2A,(Cephalaria_hirsuta_2A,Cephalaria_humilis_2A)79.765)97.188)89.714)71.366)100)65.129)100)99.9,(((Diervilla_sessilifolia_2B,Weigela_hortensis_2B)98.525,(Heptacodium_miconioides_2B,(Lonicera_heteroloba_2B,Triosteum_himalayanum_2B)99.45)97.688)91.589,(((Morina_longifolia_2Ba,(Cryptothladia_chinensis_2Ba,Cryptothladia_kokonorica_2Ba)85.614)99.975,(Morina_longifolia_2Bb,(Cryptothladia_chinensis_2Bb,Cryptothladia_kokonorica_2Bb)79.203)100)69.316,((Patrinia_triloba_2B,(Kolkwitzia_amabilis_2B,Dipelta_floribunda_2B)100)75.166,(Triplostegia_glandulifera_2B,(((Fedia_cornucopiae_2Ba,Fedia_cornucopiae_2Bb)100,(Centranthus_ruber_2Ba,Centranthus_ruber_2Bb,Valerianella_dentata_2B)94.351)99.638,((Scabiosa_angustiloba_2Bb,Lomelosia_crenata_2Bb,Knautia_calycina_2Bb_2,(Sixalix_atropurpurea_2Bb,Pterocephalus_strictus_2Bb_1,Pycnocomon_rutifolium_2Bb_1)100,((Sixalix_farinosa_2Bb,Cephalaria_humilis_2Bb)99.763,(Pterocephalus_strictus_2Bb_2,Pycnocomon_rutifolium_2Bb_2)100)93.638)100,(Knautia_calycina_2Bb_1,Knautia_macedonica_2Bb,Pseudoscabiosa_limonifolia_2Bb,(Cephalaria_hirsuta_2Bb,(Dipsacus_pilosus_2Bb,Bassecoia_bretschneideri_2Bb)67.167)62.992,((Pseudoscabiosa_limonifolia_2Ba,(Dipsacus_pilosus_2Ba,Dipsacus_inermis_2Ba)99.988)99.513,(Bassecoia_bretschneideri_2Ba,((Knautia_calycina_2Ba_3,(Sixalix_atropurpurea_2Ba_2,Lomelosia_crenata_2Ba_2,Cephalaria_hirsuta_2Ba_1,Cephalaria_humilis_2Ba_2)89.276)99.988,((Sixalix_farinosa_2Ba,Cephalaria_humilis_2Ba_1,Knautia_calycina_2Ba_2)97.563,(Pterocephalus_strictus_2Ba_1,(Scabiosa_angustiloba_2Ba,Pterocephalus_strictus_2Ba_2,Pycnocomon_rutifolium_2Ba)87.552)99.713)50.569,((Sixalix_atropurpurea_2Ba_1,Lomelosia_crenata_2Ba_1,(Knautia_calycina_2Ba_1,Knautia_macedonica_2Ba)99.588)100,(Sixalix_atropurpurea_2Ba_3,Sixalix_atropurpurea_2Ba_4,Pterocephalus_strictus_2Ba_3,Cephalaria_hirsuta_2Ba_2)100)99.825)97.813)93.113)100)83.477)100)69.204)51.894)97.188)100)100)100)100)0; [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr91300] END;