#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on October 18, 2021; 17:07 GMT TreeBASE (cc) 1994-2008 Study reference: Hernandez restrepo M., Groenewald J.Z., Crous P.W., & Elliott M. 2016. take-all or nothing. Studies in Mycology, 83: 19-48. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S20565] [ The following blocks are input data for analysis step 20109 ] BEGIN TAXA; TITLE TaxaForAnalysisStep20109; DIMENSIONS NTAX=64; TAXLABELS _Gaeumannomyces_tritici_CBS_131293 _Gaeumannomyces_tritici_CBS_186.65 _Gaeumannomyces_tritici_CBS_247.29 _Gaeumannomyces_tritici_CPC_26277 _Gaeumannomyces_tritici_CPC_26283 _Magnaporthiopsis_maydis_CBS_662.82A _Magnaporthiopsis_poae_M48 Buergenerula_spartinae_ATCC_22848 Bussabanomyces_longisporus_CBS_125232 Falciphoriella_oryzae_R561_ Falciphoriella_solaniterrestris_CBS_117.83 Gaeumannomycella_caricis_26262 Gaeumannomycella_caricis_CBS_388.81 Gaeumannomyces_arxii_CBS_902.73 Gaeumannomyces_arxii_CBS_903.73 Gaeumannomyces_arxii_CPC_26054 Gaeumannomyces_australiensis_CPC_26058_ Gaeumannomyces_avenae_CBS_187.65 Gaeumannomyces_avenae_CBS_870.73 Gaeumannomyces_californicus_CPC_26044 Gaeumannomyces_caricis_26245 Gaeumannomyces_ellisiorum_CBS387.81 Gaeumannomyces_floridanus_CPC_26037 Gaeumannomyces_fusiformis_CPC_26068_ Gaeumannomyces_glycinicola_26266 Gaeumannomyces_glycinicola_CPC_26057 Gaeumannomyces_graminicola_CPC_26025_ Gaeumannomyces_graminicola_M53 Gaeumannomyces_graminis_CPC_26020 Gaeumannomyces_graminis_CPC_26033_ Gaeumannomyces_graminis_CPC_26035 Gaeumannomyces_graminis_CPC_26045 Gaeumannomyces_graminis_M54 Gaeumannomyces_graminis_M57 Gaeumannomyces_hyphopodioides_CBS_350.77 Gaeumannomyces_hyphopodioides_CBS_541.86 Gaeumannomyces_hyphopodioides_CPC_26247 Gaeumannomyces_oryzinus_CBS_235.32 Gaeumannomyces_oryzinus_CPC_26032 Gaeumannomyces_oryzinus_CPC_26043 Gaeumannomyces_oryzinus_CPC_26065_ Gaeumannomyces_oryzinus_CPC_26066 Gaeumannomyces_oryzinus_CPC_26067 Gaeumannomyces_radicicola_CBS_149.85 Gaeumannomyces_radicicola_CBS_296.53 Gaeumannomyces_setariicola_CPC_26059 Gaeumannomyces_sp._CPC_26284 Gaeumannomyces_tritici_CBS_249.29_ Gaeumannomyces_tritici_CBS_905.73 Gaeumannomyces_tritici_CPC_26069_ Gaeumannomyces_tritici_R3111a1 Gaeumannomyces_walkerii_CPC_26028 Kohlmeyeriopsis_medullaris_JK5528S Magnaporthiopsis_incrustans_M35_ Magnaporthiopsis_maydis_CBS_133165 Magnaporthiopsis_poae_M23__ Magnaporthiopsis_sp._CPC_26038 Nakataea_oryzae_CBS_252.34 Neogaeumannomyces_bambusicola_MFLUCC11_0390_ Omnidemptus_affinis_ATCC_200212_ Pseudophialophora_eragrostis_CM12m9 Pyricularia_grisea_BR0029 Pyricularia_grisea_CR0024 Slopeiomyces_cylindrosporus_CBS_609.75 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M40042] TITLE Gaeumannomyces_LSU_RPB1; LINK TAXA = TaxaForAnalysisStep20109; DIMENSIONS NCHAR=1461; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] _Gaeumannomyces_tritici_CBS_131293 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAGAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCCGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC _Gaeumannomyces_tritici_CBS_186.65 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTCCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC _Gaeumannomyces_tritici_CBS_247.29 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTGCAAA?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC _Gaeumannomyces_tritici_CPC_26277 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC _Gaeumannomyces_tritici_CPC_26283 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTCCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC _Magnaporthiopsis_maydis_CBS_662.82A ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTCGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCGGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCACCGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCCGGAGTGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTCTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAACGACGAAGGCTTTTTGGACGCCATCCGGACGCGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGATATGTGCAAAGACAAGAAGTTCTGCGAGAATGAGACGACCAAGAAGGGCGCCGATAAAGAAGGGGGGTTCGACGACAACCCAAAACCACAACAGAACGCCAAGGTCCCCCACGGTGGATGCGGTAGTGCCCATCCAAATATCCGTCAGAAGGCCTTGGCGCTTTTTGCAAGGGTCAAGGGTGAGGGTGGCGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCACGGCCGAGATGGCCCATGCTGTCTTCAAGAAGATCTCAGATGAGGACCTGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATCGTCACTGTGCTGCCTGTCCCTCCTCCTCCGGTGCGGCCCAGTATCTCGATGGACGGTACCGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATTCGCGCAAACGGAAATGTAAAGCAGGCGATCCAGGACGGCGCACCGGCCCACATCTGCCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC _Magnaporthiopsis_poae_M48 ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCACCGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCCGGCGCGCAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAATGACGAAGGCTTTTTGGACGCCATCCGGACACGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGATATGTGCAAGGACAAGAAGTTCTGTGAGAACGAGACGACCAAGAAGGGCGCCGACAAAGAAGGGGCGTTCGACGACAACCCAAAACCACAACAGAACGCCAAGGTCCCCCACGGTGGATGCGGTAGCGCCCATCCAAATATCCGTCAGAAGGCCTTGGCGCTTTTTGCAAGGGTAAGGGGCGAGGGTGGCGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCACGGCCGAGACGGCCCATGCCATCTTCAAGAAGATCTCAGATGAGGATCTGTGGAACATGGGCCTGAACAAGGACTACGCGCGCCCCGAGTGGCTCATCGTCACTGTGCTGCCTGTGCCTCCTCCTCCAGTGCGGCCCAGTATCTCGATGGACGGTACCGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATTCGCGCCAACGGAAACGTGAAGCAGGCGATCCAAGACGGCGCACCGGCGCACATCTGCCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Buergenerula_spartinae_ATCC_22848 ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCGCAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ACAACGACGAAGGCTTTTTGGACGCTATTAGGACGCGCGATCCCAAGGTGCGCTTCGCCCGCGTCTGGGCCATGTGCAAGGACAAGAAATTCTGCGAAAACGAAACCACTAAGAAGGAGAGCGAAAAAGAAGGG---TTCGAGTCC---TCAAAACAACAA---GTCACCAAGGTCCCGCACGGAGGATGCGGCAGCTCACATCCCGACATTCGCCAAAAGGCCCTGGCACTTTTCGCGAGAGTAAAGGGCGAGGGCAACGACGAAGAAGGCGGCGCCCAGAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCTCACGCCGTGTTCAAGAAGATCTCGGACGAGGACCTGTGGAACATGGGCCTCAACAAGGACTACGCGCGCCCCGAGTGGCTTATCGTCACTGTGCTTCCTGTGCCTCCCCCTCCAGTGCGCCCGAGTATTTCGATGGACGGTACTGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATCCGCGCCAACGGAAACGTGAAGCAGGCAATCCAGGAAGGCGCGCCGGCCCATATCTGTCTCGAGTTCGAGGAGCTTCTGCAGTACCACGTCGCCAC Bussabanomyces_longisporus_CBS_125232 ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCGGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCATAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCATGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ACAATGACGAGGGCTTCGCCGACGCGATCCGCACACGCGATCCGAAGGTGCGTTTTAATCGAGTCTGGGCTCTTTGCAAGGACAAGAAGTACTGCGAGAACGAGACGACCAAGAAGGGCAGCGACAAGGACGAG---TTCGACCCC---ACAAAATCCAAG---GAAGTTAAGAAATCACATGGAGGCTGTGGCAACGAGCACCCCGAGATTCGCGACAAGGCTCTACAGCTGTATGCCAAGATCAAGGTCGACGAGAATCGCGAGGAGGGCGG------CAAAAAGGAGGTCAAGGAACGGATCATCACTCCCGAGATGGCCCACCACATCTTCAAGAGGATTTCCGACGAGGATCTACGCAATATGGGTCTGAATAAGGACTATGCTCGCCCGGAGTGGCTCATCATTACCGTCCTGCCGGTACCCCCTCCTCCGGTCCGTCCCAGCATCTCGATGGACGGTACGGGCCAGGGAATGCGCAACGAGGATGACTTGACGTACAAGCTCGGCGACATCATCCGTGCAAACGGCAACGTGAAGCAGGCGCAGTCGGACGGTGCGCCGGCTCACATCTGCCACGAGTTCGAGGAGTTGCTGCAGTACCATGTCGCAAC Falciphoriella_oryzae_R561_ ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCTCTCGGGGAGTGTTATAGCCCGTTGCGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACGCGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCTATGTGCAAGGACAAGAAGTTCTGCGAGAACGAGACGACCAAGAAGGGCGGCGACAAAGAGGGG---TTCGAGTCT---TCAAAACCACAA---GTCGCCAAGGTCCCGCACGGAGGATGCGGCAGCTCACACCCAGACATCCGCCAGAAGGCGTTGGCACTTTTTGCGAGGGTAAAGGGCGAGAACAACGACGAAGAAGGTG---CTCAAAAGAAGGAGATCAAGGACAAGCCCATCTCGGCCGAGACGGCCCACGCTGTCTTCAAGAAGATCTCGGACGAGGACCTGTGGAACATGGGCCTGAACAAGGACTACGCGCGCCCCGAGTGGCTCATCGTCACAGTACTGCCTGTTCCTCCTCCTCCAGTGCGACCCAGTATCTCGATGGACGGTACCGGCACGGGGATGCGCAACGAGGACGACTTGACCTACAAGCTTGGTGACATCATCCGCGCCAACGGAAACGTGAAGCAGGCGATCCAGGACGGCGCGCCGGCCCACATCTGTCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Falciphoriella_solaniterrestris_CBS_117.83 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCGTCGCGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGATGCCATCCGGACGCGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCTATGTGCAAGGATAAGAAGTTCTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAAGAAGGG---TTCGAGTCC---TCAAAACCACAA---GTCACCAAGGTCCCGCACGGAGGATGCGGCAGCGCACATCCAGACATCCGCCAGAAGGCCTTGGCACTTTTTGCGAGGGTGAAGGGCGAGAATAACGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAAAGACAAGCCTATCTCAGCCGAGACGGCCCACGCTGTCTTCAAGAAGATCTCGGACGAGGATCTGTGGAATATGGGCCTGAACAAGGACTACGCACGCCCCGAGTGGCTCATCGTCACAGTACTGCCTGTTCCTCCTCCTCCAGTGCGGCCCAGTATCTCGATGGACGGCACCGGCACAGGAATGCGCAACGAGGACGACTTGACCTACAAGCTCGGCGATATCATCCGCGCCAACGGAAACGTGAAGCAGGCGATCCAGGATGGCGCGCCGGCCCACATCTGTCTCGAGTTCGAGGAGCTGCTACAGTACCACGTCGCCAC Gaeumannomycella_caricis_26262 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGTGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGCCACCGAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCTGGCGGATCA-TCCGGCGTTCTCGCCGG-TGCACTCCGCCAGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCAGGAACGTGGCTCCTCTCGGGGAGTGTTATAGCCTGTTGCAGAATACCCCGGTGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTAAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAGGGATTCGCCGACGCCATTCGGACACGCGATCCCAAGGTGCGCTTTGCTCGCGTCTGGGCCATGTGCAAGGACAAGAAGTTCTGTGAGAACGATGAGAACAAGAAGAGCG---ACAAGGACAAC---TTCGACTCT---TCGAAACCGCAG---CCCACCAAGATTCCGCACGGCGGCTGTGGGAGTCTACATCCAGACATTCGCCAAAAGGCCTTGCAGCTATTTGCCAGGGTCAAAGGCGAGAACAGCGACGAGGAGGGTG---CTCCGAAGAAGGAGATCAAAGACAGGCAGATTACGCCTGAGACAGCCCATCACATCTTCAAGAAGATCTGCGACGAGGATCTGTGGAACATGGGTCTGAACAAGGACTACGCGCGCCCGGAGTGGCTCATAGTCACGGTCCTGCCCGTGCCTCCTCCTCCAGTCCGACCTAGTATCTCGATGGACGGGACCGGCGTCGGGATGCGCAACGAAGACGATTTGACTTACAAGCTTGGCGACATCATCCGTGCCAACGGAAACGTGAAGCAGGCGATACAGGATGGTGCGCCGGCCCACATCTGTCACGAGTTTGAGGAGTTGCTACAGTACCACGTCGCCAC Gaeumannomycella_caricis_CBS_388.81 ????????????????????????????ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGTGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGCCACCGAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCTGGCGGATCA-TCCGGCGTTCTCGCCGG-TGCACTCCGCCAGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCAGGAACGTGGCTCCTCTCGGGGAGTGTTATAGCCTGTTGCAGAATACCCCGGTGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTAAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAGGGATTCGCCGACGCCATTCGGACACGCGATCCCAAGGTGCGCTTTGCTCGCGTCTGGGCCATGTGCAAGGACAAGAAGTTCTGTGAGAACGATGAGAACAAGAAGAGCG---ACAAGGACAAC---TTCGACTCT---TCGAAACCGCAG---CCCACCAAGATTCCGCACGGCGGCTGTGGGAGTCTACATCCAGACATTCGCCAAAAGGCCTTGCAGCTATTTGCCAGGGTCAAAGGCGAGAACAGCGACGAGGAGGGTG---CTCCGAAGAAGGAGATCAAAGACAGGCAGATTACGCCTGAGACAGCCCATCACATCTTCAAGAAGATCTGCGACGAGGATCTGTGGAACATGGGTCTGAACAAGGACTACGCGCGCCCGGAGTGGCTCATAGTCACGGTCCTGCCCGTGCCTCCTCCTCCAGTCCGACCTAGTATCTCGATGGACGGGACCGGCGTCGGGATGCGCAACGAAGACGATTTGACTTACAAGCTTGGCGACATCATCCGTGCCAACGGAAACGTGAAGCAGGCGATACAGGATGGTGCGCCGGCCCACATCTGTCACGAGTTTGAGGAGTTGCTACAGTACCACGTCGCCAC Gaeumannomyces_arxii_CBS_902.73 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCGCTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGGCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGTCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_arxii_CBS_903.73 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCGCTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGGCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGTCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_arxii_CPC_26054 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGGCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCGCTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGGCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGTCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_australiensis_CPC_26058_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ACAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGTGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGCGGCGACAAGGACAGC---TTCGAAACCACCTCAAAGCCACAG---GTCACCAAGGCCCCCCATGGTGGCTGTGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTCTTCGCAAGGGTAAAAAGCGAGACCAGCGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGATGAAGACCTGTGGAACATGGGTCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGACCCAGCATCTCGATGGACGGCACCGGCACAGGAATGCGCAACGAGGACGATTTGACCTACAAGCTTGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCGGCCCACATCTGTCTCGAGTTTGAGGAGCTGCTGCAGTACCACGTCGCCAC Gaeumannomyces_avenae_CBS_187.65 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTTGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAG???????????????????????????????ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACAGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTATCACGTCGCCAC Gaeumannomyces_avenae_CBS_870.73 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTATCACGTCGCCAC Gaeumannomyces_californicus_CPC_26044 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGTTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGTGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGACAGC---TTCGAAACCACCTCGAAGCCACAG---GTCACCAAGGTTCCCCATGGTGGCTGTGGCAGCGCACACCCAAACATTCGCCAGAAGGCATTGGCACTCTTCGCAAGGGTAAAAAGCGAGACCAGCGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGACGAAGACCTGTGGAACATGGGTCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATAGTCACGGTGCTACCTGTGCCGCCTCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATCCGTGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCGGCCCACATCTGTCTCGAGTTTGAGGAGTTGCTGCAGTACCACGTCGCCAC Gaeumannomyces_caricis_26245 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGTGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCTCTCGGGGAGTGTTATAGCCCGTTGCATAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTAAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGTTTCGCCGACGCCATCCGGACACGCGACCCCAAGGTGCGCTTTGCGCGCGTCTGGGCGATGTGCAAGGATAAGAAGTTTTGCGAAAACGACGAGACGAAGAAGGGCGGTGACAAGGAAGGC---TTCGAGTCC---TCAAAACCTCAG---GCCATCAAGATGCCCCACGGCGGCTGTGGCAGCCAACATCCAGACATCCGTCAGAAGGCCCTGCAACTATTTGCTAGGGTCAAGGACGTGAACAACGACGAGGAGGGCG---GGGCGAAGAAGGAGATCAAGGACAAGCAGATCACAGCAGAGACAGCGCATCATGTTTTCAAGAAGATTTCCGACGACGATCTGTGGAATATGGGTCTGAACAAGGACTACGCACGACCAGAGTGGCTCATCGTCACTGTTCTGCCCGTACCCCCTCCTCCAGTCCGTCCTAGCATCTCGATGGACGGTACGGGCCAGGGAATGCGCAACGAAGATGATTTGACGTACAAGCTTGGCGACATCATCCGCGCCAATGGCAACGTCAAGCAGGCAATCCAGGATGGCGCGCCGGCCCACATCTGCCACGAGTTCGAGGAACTGCTCCAGTACCACGTCGCGAC Gaeumannomyces_ellisiorum_CBS387.81 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCCGTCGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTAAACGTAGATGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCTATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAAAACGAGACGACCAAGAAGAG---CGACAAGGATGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCATGGCGGATGCGGTAGCGCACACCCAAACATCCGCCAGAAGGCGTTGGCACTTGTCGCGAGGGTCAAAGGCGAGACGAACGACGAAGATACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCACGCCCGAGATGGCCCACTCAGTCCTCAAGAAGATCTCAGAAGAAGACATGTGGAACATGGGTCTGAACAAGGATTACGCACGCCCCGAATGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGACCTAGCATCTCGATGGACGGCACCGGCACAGGAATGCGCAACGAGGACGATTTGACCTACAAGCTTGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_floridanus_CPC_26037 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTAGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GCCACCAAGGTCCCCCATGGAGGATGTGGCAGCGCACACCCAAATATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTGTGGAACATGGGGCTGAACAAAGATTACGCGCGCCCCGAGTGGCTCATCGTTACGGTGCTGCCTGTGCCGCCTCCCCCAGTGCGACCTAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGACTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAACTGTTGCAATACCACGTCGCTAC Gaeumannomyces_fusiformis_CPC_26068_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGTCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCTCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACGCGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCGATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCT---TCAAAACCACAA---GTCACCAAGGTCCCCCATGGCGGATGTGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCATGCCGTCTTCAAGAAGATCTCAGACGAGGACCTGTGGAACATGGGGCTGAACAAAGATTACGCGCGCCCCGAGTGGCTCATCGTTACGGTGCTGCCTGTGCCGCCTCCCCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAACTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_glycinicola_26266 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCGCTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGGCTGAGACGGCCCACGCTGTTCTCAAGAAGATCTCAGAAGAAGACATGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGCACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAACAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_glycinicola_CPC_26057 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCGCTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGGCTGAGACGGCCCACGCTGTTCTCAAGAAGATCTCAGAAGAAGACATGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGCACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAACAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_graminicola_CPC_26025_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACGCGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCT---TCAAAACCACAA---GTCACCAAGGTGCCCCATGGCGGATGTGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCATCTTCAAGAAGATCTCAGACGAAGACCTGTGGAACATGGGGCTGAACAAAGATTACGCGCGCCCCGAGTGGCTCATCGTTACGGTGCTGCCTGTGCCGCCTCCCCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAACTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_graminicola_M53 ??????????????????????????????????ATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCC?--AGGCCCG?GTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACGCGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCT---TCAAAACCACAA---GTCACCAAGGTGCCCCATGGCGGATGTGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCATCTTCAAGAAGATCTCAGACGAAGACCTGTGGAACATGGGGCTGAACAAAGATTACGCGCGCCCCGAGTGGCTCATCGTTACGGTGCTGCCTGTGCCGCCTCCCCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAACTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_graminis_CPC_26020 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAATCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGATTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGACGGA---TTCGAATCC---TCAAAGCCACAA---GTCACCAAGGTACCCCATGGCGGCTGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAGTGAGACCAACGACGAGGAAACCG---CCCAGAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGACGAAGACCTGTGGAACATGGGGCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGTATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_graminis_CPC_26033_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAATCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGATTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGACGGA---TTCGAATCC---TCAAAGCCACAA---GTCACCAAGGTACCCCATGGCGGCTGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAGTGAGACCAACGACGAGGAAACCG---CCCAGAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGACGAAGACCTGTGGAACATGGGGCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGTATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_graminis_CPC_26035 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAATCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGATTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGACGGA---TTCGAATCC---TCAAAGCCACAA---GTCACCAAGGTACCCCATGGCGGCTGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAGTGAGACCAACGACGAGGAAACCG---CCCAGAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGACGAAGACCTGTGGAACATGGGGCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGTATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_graminis_CPC_26045 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAATCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGATTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGACGGA---TTCGAATCC---TCAAAGCCACAA---GTCACCAAGGTACCCCATGGCGGCTGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAGTGAGACCAACGACGAGGAAACCG---CCCAGAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGACGAAGACCTGTGGAACATGGGGCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGTATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_graminis_M54 ?????????????????????????????????CATTGCCCTAGTA-CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-??GCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTAGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GCCACCAAGGTCCCCCATGGAGGATGTGGCAGCGCACACCCAAATATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTGTGGAACATGGGGCTGAACAAAGATTACGCGCGCCCCGAGTGGCTCATCGTTACGGTGCTGCCTGTGCCGCCTCCCCCAGTGCGACCTAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGACTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAACTGTTGCAATACCACGTCGCTAC Gaeumannomyces_graminis_M57 ??????????????????????????????????ATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAATCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGATTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCAAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAATTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGACGGA---TTCGAATCC---TCAAAGCCACAA---GTCACCAAGGTACCCCATGGCGGCTGCGGCAGCGCACACCCAAACATCCGTCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAGTGAGACCAACGACGAGGAAACCG---CCCAGAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCGGACGAAGACCTGTGGAACATGGGGCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGTATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_hyphopodioides_CBS_350.77 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCATACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTACGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTCGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGGAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACAACCAAGAAGGGCGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCATCA---GTCACAAAGGTCCCGCATGGCGGATGCGGCAGCGCACACCCGAACATCCGCCAGAAGGCACTGGCGCTTTTCGCGAGGGTAAAAGGCGAGAATAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTTAGCCGAGACGGCCCACGCCATCTTCAAGAAGATCTCAGACGAAGATCTGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCTCCTCCTCCGGTGAGGCCCAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGATTTGACATACAAGCTCGGCGACATCATTCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGATGGTGCACCAGCCCACATCTGTCTCGAGTTTGAGGAGCTATTACAGTACCATGTCGCTAC Gaeumannomyces_hyphopodioides_CBS_541.86 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCATACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTACGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGT{CT}GTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGGCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGGAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACAACCAAGAAGGGCGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCATCA---GTCACAAAGGTCCCGCATGGCGGATGCGGCAGCGCACACCCGAACATCCGCCAGAAGGCACTGGCGCTTTTCGCGAGGGTAAAAGGCGAGAATAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTTAGCCGAGACGGCCCACGCCATCTTCAAGAAGATCTCAGACGAAGACCTGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCTCCTCCTCCGGTGAGGCCCAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGATTTGACATACAAGCTCGGCGACATCATTCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGATGGTGCACCAGCCCACATCTGTCTCGAGTTTGAGGAGCTATTACAGTACCATGTCGCTAC Gaeumannomyces_hyphopodioides_CPC_26247 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCATACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTACGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTCGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGT???????????????????????????ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGGAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACAACCAAGAAGGGCGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCATCA---GTCACAAAGGTCCCGCATGGCGGATGCGGCAGCGCACACCCGAACATCCGCCAGAAGGCACTGGCGCTTTTCGCGAGGGTAAAAGGCGAGAATAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTTAGCCGAGACGGCCCACGCCATCTTCAAGAAGATCTCAGACGAAGATCTGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCTCCTCCTCCGGTGAGGCCCAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGATTTGACATACAAGCTCGGCGACATCATTCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGATGGTGCACCAGCCCACATCTGTCTCGAGTTTGAGGAGCTATTACAGTACCATGTCGCTAC Gaeumannomyces_oryzinus_CBS_235.32 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGATGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACCAGAAGTTTTGTGAGAACGACACGACCAATAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCTCATGGCGGATGTGGCAGCGCATACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCTAGGGTAAAAAACGAGAGTAACGACGAGGAAACTG---CCCAAAAAAAGGAGATCAAAGACAATCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCACACTACTACCTATGGAACATGGGATTGAACAAAGATTATGCGCGCCCCGAGTGGCTCATCGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGTACCGGCTCGGGAATGCGCATCTAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCCCCAATGGCAACGTGAAACAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_oryzinus_CPC_26032 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGATGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCTCATGGCGGATGTGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACTG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTATGGAACATGGGACTGAACAAAGATTATGCGCGCCCCGAGTGGCTCATCGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAATGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_oryzinus_CPC_26043 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGATGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCTCATGGCGGATGTGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACTG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTATGGAACATGGGACTGAACAAAGATTATGCGCGCCCCGAGTGGCTCATCGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAATGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_oryzinus_CPC_26065_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGATGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCTCATGGCGGATGTGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACTG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTATGGAACATGGGACTGAACAAAGATTATGCGCGCCCCGAGTGGCTCATCGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAATGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_oryzinus_CPC_26066 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGATGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCTCATGGCGGATGTGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACTG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTATGGAACATGGGACTGAACAAAGATTATGCGCGCCCCGAGTGGCTCATCGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAATGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_oryzinus_CPC_26067 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCTAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGATGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACGACCAAGAAGGGTGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCTCATGGCGGATGTGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTAAAAAACGAGAGTAACGACGAGGAAACTG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCGTCTTCAAGAAGATCTCAGACGAAGACCTATGGAACATGGGACTGAACAAAGATTATGCGCGCCCCGAGTGGCTCATCGTCACGGTGCTGCCTGTGCCGCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATCCGCGCCAATGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCTAC Gaeumannomyces_radicicola_CBS_149.85 ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCGTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTGCGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGGAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACAACCAAGAAGGGCGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCGCATGGCGGATGCGGCAGCGCACACCCGAACATTCGCCAGAAGGCACTGGCGCTTTTCGCGAGGGTAAAAGGCGAGAATAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCAGCCGAGACAGCCCACGCTATCTTCAAGAAGATCTCAGACGAAGATCTGTGGAACATGGGCCTGAACAAGGATTACGCACGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCTCCTCCTCCAGTGAGGCCCAGCATCTCGATGGACGGCACTGGCACAGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGACATCATTCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGATGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCATGTCGCTAC Gaeumannomyces_radicicola_CBS_296.53 ????????????????????????????ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCGTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTGCGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTC?????????????????????????ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGGAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACAACCAAGAAGGGCGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCGCATGGCGGATGCGGCAGCGCACACCCGAACATTCGCCAGAAGGCACTGGCGCTTTTCGCGAGGGTAAAAGGCGAGAATAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCAGCCGAGACAGCCCACGCTATCTTCAAGAAGATCTCAGACGAAGATCTGTGGAACATGGGCCTGAACAAGGATTACGCACGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCTCCTCCTCCAGTGAGGCCCAGCATCTCGATGGACGGCACTGGCACAGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGACATCATTCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGATGGTGCGCCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCATGTCGCTAC Gaeumannomyces_setariicola_CPC_26059 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTCGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGTGAGAACGAGACAACCAAGAAGGGCGGCGACAAGGAGGGG---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTCCCGCATGGCGGATGCGGCAGCGCACACCCGAACATCCGCCAGAAGGCACTGGCGCTTTTCGCGAGGGTAAAAAGCGAGAATAACGACGAGGAAACCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCTCGGCCGAGACGGCCCACGCCATCTTCAAGAAGATCTCAGACGAAGACCTGTGGAACATGGGCCTGAACAAGGACTACGCGCGCCCCGAGTGGCTCATAGTCACGGTGCTGCCTGTGCCTCCTCCTCCAGTGAGGCCCAGCATCTCGATGGACGGCACTGGCACGGGAATGCGCAACGAGGACGATTTGACTTACAAGCTCGGCGATATCATTCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGATGGTGCACCAGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTACAGTACCATGTCGCTAC Gaeumannomyces_sp._CPC_26284 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTGTTGCGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Gaeumannomyces_tritici_CBS_249.29_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAGAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_tritici_CBS_905.73 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAGCGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_tritici_CPC_26069_ ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAGAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_tritici_R3111a1 ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCATACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTACGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTCGTTTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACCACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCTCAA---GTCACCAAGGTTCCCCATGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCACTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATCAAAGACAAGCCCATCACGCCCGAGACGGCCCACGCTGTTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCTAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACCTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTCGAGGAGCTGTTGCAGTACCACGTCGCCAC Gaeumannomyces_walkerii_CPC_26028 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCAAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTATGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCTCAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGCTTCTTGGACGCCATCCGGACACGGGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGCTATGTGTAAGGACAAGAAGTTCTGTGAGAACGAGACTACCAAGAAGGGCGGCGACAAGGATGGC---TTCGAATCC---TCAAAACCACAA---GTCACCAAGGTTCCCCACGGCGGATGCGGCAGCGCACACCCAAACATCCGCCAGAAGGCATTGGCGCTTTTCGCGAGGGTGAAAGGCGAGACGAACGACGAGGAGACTG---CCCAAAAGAAGGAAATAAAAGACAAGCCCATCACGGCCGAGACGGCCCACGCTATTCTCAAGAAGATCTCGGAAGAAGACATGTGGAATATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATTGTCACGGTGCTGCCTGTGCCGCCCCCTCCAGTGCGGCCCAGCATCTCGATGGACGGCACCGGTACAGGAATGCGCAACGAAGACGATTTGACTTACAAGCTCGGTGATATCATCCGCGCCAACGGCAACGTGAAGCAGGCGATCCAAGACGGTGCGCCTGCCCACATCTGTCTCGAGTTTGAGGAGCTGTTGCAGTACCACGTCGCCAC Kohlmeyeriopsis_medullaris_JK5528S ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCA--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCAATTCAGCCTTCGGGCTGGGTGCGCTCTGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGATAAAAGCTTCGGGAACGTAGCTCCCTACGGGGAGTGTTATAGCCCGTTGCATAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAACGATGAAGGTTTCGCCGACGCCATCCGGACACGCGACCCCAAGGTGCGCTTTGCGCGTGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGCGAAAACGACGAGACGAAGAAGGGCGGTGACAAGGAAGGG---TTCGAGTCC---TCGAAGCCCCAA---GCCGTCAAGATGCCGCACGGCGGCTGTGGCAGTCAACACCCCGACATCCGTCAGAAGGCTTTGCAGCTATTCGCCAGGGTCAAGGACGTGAACAACGATGAGGAGGGCG---CGACGAAGAAGGAGATCAAGGACAAGCAGATCACGGCGGAGACGGCACATCATATATTCAAGAAGATCTCCGACGAGGACATGTGGAATATGGGTCTCAACAAGGACTACGCGCGCCCGGAGTGGCTCATCATCACAGTTCTCCCCGTCCCTCCTCCTCCAGTTCGCCCCAGCATCTCGATGGACGGTACGGGCCAGGGAATGCGCAACGAGGACGATTTGACATATAAGCTTGGCGACATCATCCGCGCCAACGGCAACGTCAAGCAAGCAATCCAGGATGGCGCGCCGGCCCACATTTGCCACGAGTTCGAGGAACTGTTGCAGTACCATGTCGCCAC Magnaporthiopsis_incrustans_M35_ ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCGGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCATCGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCCGGAGTGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAATGACGAAGGCTTCTTGGACGCCATCCGGACGCGCGACCCCAAGGTGCGCTTCGCCCGGGTCTGGGAGATGTGCAAGGACAAGAATTTCTGTGAGAACGAGACGACCAAGAAGGGCGCCGACAAAGAAGGGGGGTTCGACGACAACCCAAAACCACAACAGAACGCCAAGGTCCCCCACGGTGGATGCGGTAGCGCCCATCCAAATATCCGTCAGAAGGCCTTGGCGCTTTTTGCAAGGGTAAAGGGCGAGGGTGGTGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAGAGACAATCCCATCACGGCCGAGACGGCCCATGCTGTCTTCAAGAAGATCTCAGATGAGGACCTGTGGAACATGGGCCTGAACAAGGACTACGCGCGCCCCGAGTGGCTCATCGTCACTGTGCTGCCTGTCCCTCCTCCTCCAGTGCGGCCTAGCATCTCGATGGACGGTACCGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATTCTCGCCAACGGAAACGTGAATCAGGCGATCCAAGACGGCGCACCGGCCCACATCTGCCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Magnaporthiopsis_maydis_CBS_133165 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTCGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCGGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCACCGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCCGGAGTGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTCTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCACAT?ATAACGACGAAGGCTTTTTGGACGCCATCCGGACGCGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGATATGTGCAAAGACAAGAAGTTCTGCGAGAATGAGACGACCAAGAAGGGCGCCGATAAAGAAGGGGGGTTCGACGACAACCCAAAACCACAACAGAACGCCAAGGTCCCCCACGGTGGATGCGGTAGTGCCCATCCAAATATCCGTCAGAAGGCCTTGGCGCTTTTTGCAAGGGTCAAGGGTGAGGGTGGCGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCACGGCCGAGATGGCCCATGCTGTCTTCAAGAAGATCTCAGATGAGGACCTGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCTGAGTGGCTCATCGTCACTGTGCTGCCTGTCCCTCCTCCTCCGGTGCGGCCCAGTATCTCGATGGACGGTACCGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATTCGCGCAAACGGAAATGTAAAGCAGGCGATCCAGGACGGCGCACCGGCCCACATCTGCCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Magnaporthiopsis_poae_M23__ ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--GGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCACCGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCTGGGGCGCAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAATGACGAAGGCTTTTTGGACGCCATCCGGACACGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGATATGTGCAAGGACAAGAAGTTCTGTGAGAACGAGACGACCAAGAAGGGCGCCGACAAAGAAGGGGCGTTCGACGACAACCCAAAACCACAACAGAACGCCAAGGTCCCCCACGGTGGATGCGGTAGCGCCCATCCAAATATCCGTCAGAAGGCCTTGGCGCTTTTTGCAAGGGTAAGGGGCGAGGGTGGCGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCACGGCCGAGACGGCCCATGCCATCTTCAAGAAGATCTCGGATGAGGATCTGTGGAACATGGGCCTGAACAAGGACTACGCGCGCCCCGAGTGGCTCATCGTCACTGTGCTGCCTGTGCCTCCTCCTCCAGTGCGGCCCAGTATCTCGATGGACGGTACCGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATTCGCGCCAACGGAAACGTGAAGCAGGCGATCCAGGACGGCGCACCGGCGCACATCTGCCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Magnaporthiopsis_sp._CPC_26038 ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCC--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCGCTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCACCGGGAATGTGGCTCCCCTCGGGGAGTGTTATAGCCCGGAGTGTAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTGGTGCGAGTGTTTGGGTGTGAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCATCAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGATGAAGGCTTTTTGGACGCCATCCGGACACGCGACCCCAAGGTGCGCTTCGCCCGTGTCTGGGATATGTGCAAGGACAAGAAGTTCTGTGAGAACGAGACGACCAAGAAGGGCGCCGACAAAGAAGGGGGGTTCGACGACAACCCAAAACCACAACAGAACGCCAAGGTGCCCCACGGTGGATGCGGTAGTGCACATCCAAGTATCCGTCAGAAGGCCTTGGCGCTTTTTGCAAGGGTAAAGGGCGAGGGTGGCGACGAAGAAGGCG---CCCAAAAGAAGGAGATCAAAGACAAGCCCATCACGGCCGAGACGGCCCATGCTATCTTCAAGAAGATCTCGGATGAGGACCTGTGGAACATGGGCCTGAACAAGGATTACGCGCGCCCCGAGTGGCTCATCGTCACCGTGCTGCCTGTCCCTCCTCCTCCAGTGCGGCCCAGTATCTCGATGGACGGTACCGGCACGGGAATGCGCAACGAGGACGATTTGACCTACAAGCTCGGCGATATCATTCGCGCCAACGGAAACGTGAAGCAGGCGATCCAGGACGGCGCGCCGGCCCACATCTGCCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Nakataea_oryzae_CBS_252.34 ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAAGCGCTTACCGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGATTTTCGCCGGGGGACAAAAGCTTCGGGAACGTGGCTCTCTTCGGGGAGTGTTATAGCCCGTTGCGTAATACCCCGGCGGGGATCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAACGACGAAGGCTTTTTGGACGCCATCCGGACACGCGACCCCAAGGTGCGCTTCGCCCGCGTCTGGGCAATGTGCAAGGACAAGAAGTTTTGCGAAAACGAAACTACGAAGAAGGGTGGCGACAAAGAGGGG---TTTGAGTCG---TCAAAACCCCAG---GTCACCAAGGTGCCGCACGGTGGCTGTGGCAGCGCGCACCCCGACATCCGTCAGAAGGCCTTGGCGCTCTTTGCCAGGGTAAAGGGCGAGAACAACGACGAGGAAGGCG---GCCAAAAGAAGGAGATCAAGGACAAGCCTATCTCGGCCGAGACGGCCCATGCCATCTTCAAGAAGATCTCAGATGAGGACCTGTGGAACATGGGCCTGAACAAGGACTACGCGCGCCCCGAGTGGCTTATCGTCACGGTTCTTCCCGTTCCTCCTCCTCCAGTACGGCCTAGTATCTCTATGGACGGTACAGGCACGGGCATGCGAAACGAGGACGATTTGACATACAAGCTCGGCGACATCATCCGTGCCAACGGAAACGTGAAGCAGGCGATCCAAGATGGCGCGCCGGCCCACATCTGCCTCGAGTTCGAGGAGTTGCTGCAATACCACGTCGCCAC Neogaeumannomyces_bambusicola_MFLUCC11_0390_ ATATCAATAAGCGGAGGAAAAGAAACAAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTCTGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGATTTTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCGTAATGCCCCGGCGGGGATCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Omnidemptus_affinis_ATCC_200212_ ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGACGCGCCTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCTGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGTCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTAGCTCCCTTCGGGGAGTGTTATAGCCCGTTGCATAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAACGACGAAGGCTTCGCCGACGCCGTCCGGACACGCGACCCCAAGGTGCGATTTGCTCGCGTCTGGGCCATGTGCAAGGACAAGAAATTTTGCGAGAACGAGACGACGAAAAAGGGTGGCGACAAGGAAGGG---TTTGAGTCG---TCAAAACCTCAG---CCCGTCAAGATCCCGCATGGTGGCTGCGGTAGCGCACATCCAGACATCCGCCAAAAGGCATTGCAGCTCTTCGCCAGGATCAAGGGCGAGAACAACGATGAAGAGGGCG---CAGCCAAGAAAGAGATCAAGGACAAACCCATCACGGCCGAGACGGCCCATGCCGTCTTCAAGAAGATCTCGGAGGAGGACATGTGGAACATGGGCCTAAACAAGGATTACGCGCGTCCGGAGTGGCTCATCGTCACTGTTCTGCCCGTACCCCCTCCTCCGGTTCGGCCAAGCATTTCCATGGATGGCACCGGCCAGGGAATGCGTAACGAAGACGATTTGACCTACAAGCTCGGCGACATCATCCGCGCCAACGGAAACGTGAAGCAGGCTATTCAAGACGGCGCGCCGGCACACATCTGTCTCGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC Pseudophialophora_eragrostis_CM12m9 ?????????????????????????????????GATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC-AGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGACGCGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGTACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGTTCGGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCCTCGGGAACGTGGCCCCCTTCGGGGGGTGTTATAGCCAGTGGCAGAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAAT?ATAACGACGAAGGGTTCGCCGACGCAATCCGCACGCGCGATCCCAAGGCCCGCTTCGCTCGTGTTTGGGCCATGTGCAAGGACAAGAAGTTCTGCGAAAATGACACTGCGACCAAGGGTGGCGAGAAGGAAGGA---TTTGAAGGC---TCCAAGACCCAA---CCCACAAAGATTCCCCACGGCGGTTGCGGCAACCGACATCCGGACATCCGCCAGAAGGCCTTGCAGCTGTACGCCAGAGTCAAAGCTGAGAGCAATGACGACGAAGGCGAAGGCCCCAAGAAGGAGGTCAAGGACAGGCTCATCACGGCCGAGGTGGCGCACCACATCTTTAAGAGGATTTCTGACGAGGACTTGTGGAACATGGGCCTCAATAAGGACTACGCACGTCCCGAGTGGCTCATAGTTACCGTCTTGCCCGTGCCGCCGCCGCCGGTCCGTCCCAGTATCTCGATGGACGGCACCGGCCAGGGCATGCGCAACGAGGATGACTTGACGTACAAGCTCGGCGACATCATCCGCGCCAACGGTAACGTGAAACAGGCGATCGCAGATGGCGCGCCGGCCCACATCTGCCACGAGTTCGAGGAGCTGCTACAGTACCACGTCGCGAC Pyricularia_grisea_BR0029 ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCACCTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCAGGCTCAGGCCAGCATCGGTTCTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTTTCGGGGAGTGTTATAGCCCGTTGCGTAATACCCCGGCGGGGACCGACGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGAAGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ACAATGACGAGCAATTTGCACAAGCCCTTCGGTTACGAGACCCAAAAGCGCGTTTCGCCATGGTGTGGAAAGCTTGCAAGGGCAAGAAGGTCTGCGAGATCGAGACCGGTGGTAAAGA---TGAAAAGGATAGT---ATCGACACC---GCAACTGGCATA------GAAAAGGTTCCCCACGGTGGCTGTGGAAGCACACATCCCGACATCCGGAAAAAGGCATTGCAGCTTTACGCCAAGGTCGAG---GAAGCCCGCGAGGAGGGAATGA---------AGAAGGAGGTCAAAGACAAGCTCATCACGCCCGAGCAGGCTCATCATATTCTCAAGCATATTCCAGAAGACGACCTGTGGAAGATGGGCTTGAACAAGGACTATGCCAGACCTGAATGGCTGATCGTCACAGTTCTGCCAGTGCCACCACCTCCTGTCAGGCCCAGTATCTCAGTTGACGGTACATCGCAGGGAATGCGTAGCGAGGATGATTTGACATACAAGCTTGGTGACATTATTCGCGCAAACGGCAACGTGAAGCAGGCCCATGCTGAGGGAGCCCCGAATCACATTTGCACCGAGTTTGAGGAGTTGCTTCAATATCATGTCGCCAC Pyricularia_grisea_CR0024 ????????????????????????????????????TGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGCACCTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTAGGACGCCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCAGGCTCAGGCCAGCATCGGTTCTCGCCGGGGGACAAAGGCTTCGGGAACGTGGCTCCTTTCGGGGAGTGTTATAGCCCGTTGCGTAATACCCCGGCGGGGACCGACGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGAAGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ACAATGACGAGCAATTTGCACAAGCCCTTCGGTTACGAGACCCAAAAGCGCGTTTCGCCATGGTGTGGAAAGCTTGCAAGGGCAAGAAGGTCTGCGAGATCGAGACCGGTGGTAAAGA---TGAAAAGGATAGT---ATCGACACC---GCAACTGGCATA------GAAAAGGTTCCCCACGGTGGCTGTGGAAGCACACATCCCGACATCCGGAAAAAGGCATTGCAGCTTTACGCAAAGGTCGAG---GAAGCCCGCGAGGAGGGAATGA---------AGAAGGAGGTCAAAGACAAGCTCATCACGCCCGAGCAGGCTCATCATATTCTCAAGCATATTCCAGAAGACGACCTGTGGAAGATGGGCTTGAACAAGGACTATGCCAGACCTGAATGGCTGATCGTCACAGTTCTGCCAGTGCCACCACCTCCTGTCAGGCCCAGTATCTCAGTTGACGGTACATCGCAGGGAATGCGTAGCGAGGATGATTTGACATACAAGCTTGGTGACATTATTCGCGCAAACGGCAACGTGAAGCAGGCCCATGCTGAGGGAGCCCCGAATCACATTTGCACCGAGTTTGAGGAGTTGCTTCAATATCATGTCGCCAC Slopeiomyces_cylindrosporus_CBS_609.75 ????????????????????????????????????TGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--AGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGTGCTTACCGAGTCCCCTGGAATGGGGCGCCACAGAGGGTGAGAGCCCCGTATGGTTTGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGCGCCGGGCGGATCA-TCCAGCGTTCTCGCTGG-TGCACTCCGCCCGGCTCAGGCCAGCATCGGTTTTCGCCGGGGGACAAAAGCTTCGGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCCGTTGCATAATACCCCGGCGGGGACCGAGGACCGCGCTTCGGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACCGAGGAGTCAAGCATTAGTGCGAGTGTTTGGGTGTAAAACCCGCACGCGTAATGAAAGTGAACGTAGGTGAGAGCTTCGGCGCATCATCGACCGATCCTGATGTTTTCGGATGGATTTGAGTAGGAGCATTAACGCTTGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCA?????????????????????????????????????????????????????????ATAACGACGAAGGCTTCGCCGACGCCATCCGGACGCGTGACCCCAAGGTGCGATTTGCTCGCGTCTGGGCCATGTGCAAGGACAAGAAGTTCTGTGAAAACGACGAGACCAAGAAAGGTGGCGACAAGGACAGC---TTCGAAACAACATCAAAACCGCCA---CCTACCAAGATCCCGCACGGCGGCTGCGGCAGCCAACACCCGGACATTCGCCAGAAGGCCCTGCAACTATTCGCTAGGGTGAAGGGCGAGAATAATGACGAGGAGGGTG---CACCCAAGAAGGAGATCAAGGATAGGCAGATCACTGCCGAGACGGCCCACCACATCTTCAAGAAGATCACCGACGAGGACCTATGGAACATGGGCCTGAACAAGGACTACGCACGCCCGGAATGGCTCATCGTCACGGTTCTCCCTGTGCCTCCTCCGCCGGTTCGCCCCAGCATCTCGATGGACGGCACAGGCCAGGGAATGCGCAACGAGGATGATTTGACCTACAAGCTTGGCGATATCATCCGCGCCAACGGAAACGTGAAGCAGGCGATCCAGGATGGCGCGCCGGCCCACATCTGCCACGAGTTCGAGGAGCTGCTGCAGTACCACGTCGCCAC ; END; [ The following blocks are output data for analysis step 20109 ] BEGIN TREES; TITLE Gaeumannomyces_MRBAYES; LINK TAXA = TaxaForAnalysisStep20109; TREE con_50_majrule = [&R] (Pyricularia_grisea_BR0029:0.014871,Pyricularia_grisea_CR0024:0.013999,((((((((((((Gaeumannomyces_tritici_CBS_905.73:0.005565,_Gaeumannomyces_tritici_CPC_26277:0.00195,(_Gaeumannomyces_tritici_CBS_186.65:0.00208,_Gaeumannomyces_tritici_CPC_26283:0.001995):0.003611,_Gaeumannomyces_tritici_CBS_247.29:0.007056,(Gaeumannomyces_tritici_CBS_249.29_:0.002097,_Gaeumannomyces_tritici_CBS_131293:0.003847,Gaeumannomyces_tritici_CPC_26069_:0.002005):0.003524,Gaeumannomyces_tritici_R3111a1:0.010679,(Gaeumannomyces_avenae_CBS_187.65:0.00587,Gaeumannomyces_avenae_CBS_870.73:0.004012):0.00655):0.012062,(Gaeumannomyces_walkerii_CPC_26028:0.01208,(Gaeumannomyces_arxii_CPC_26054:0.005368,Gaeumannomyces_arxii_CBS_902.73:0.002077,Gaeumannomyces_arxii_CBS_903.73:0.002353):0.01098):0.004228):0.013082,(Gaeumannomyces_glycinicola_CPC_26057:0.002192,Gaeumannomyces_glycinicola_26266:0.002375):0.008234):0.017556,Gaeumannomyces_ellisiorum_CBS387.81:0.057854):0.050184,((Gaeumannomyces_californicus_CPC_26044:0.016454,Gaeumannomyces_australiensis_CPC_26058_:0.016787):0.035397,(Gaeumannomyces_graminis_CPC_26033_:0.002157,Gaeumannomyces_graminis_CPC_26045:0.002182,(Gaeumannomyces_graminis_M57:0.002065,Gaeumannomyces_graminis_CPC_26020:0.002097,Gaeumannomyces_graminis_CPC_26035:0.002239):0.003796):0.020289):0.0201,((Gaeumannomyces_oryzinus_CPC_26065_:0.002041,Gaeumannomyces_oryzinus_CPC_26067:0.0022,Gaeumannomyces_oryzinus_CPC_26066:0.001957,Gaeumannomyces_oryzinus_CBS_235.32:0.037871,Gaeumannomyces_oryzinus_CPC_26032:0.001991,Gaeumannomyces_oryzinus_CPC_26043:0.002061):0.01929,(((Gaeumannomyces_graminicola_CPC_26025_:0.002384,Gaeumannomyces_graminicola_M53:0.002031):0.007467,Gaeumannomyces_fusiformis_CPC_26068_:0.013228):0.005211,(Gaeumannomyces_floridanus_CPC_26037:0.002201,Gaeumannomyces_graminis_M54:0.003833):0.019178):0.01002):0.010943):0.012748,(((Gaeumannomyces_hyphopodioides_CBS_350.77:0.002048,Gaeumannomyces_hyphopodioides_CPC_26247:0.002411,Gaeumannomyces_hyphopodioides_CBS_541.86:0.005473):0.017491,(Gaeumannomyces_radicicola_CBS_149.85:0.002443,Gaeumannomyces_radicicola_CBS_296.53:0.002302):0.021309):0.015312,Gaeumannomyces_setariicola_CPC_26059:0.007244):0.032059):0.08457,((Magnaporthiopsis_sp._CPC_26038:0.033427,(((Magnaporthiopsis_poae_M23__:0.006967,_Magnaporthiopsis_poae_M48:0.005041):0.02094,Magnaporthiopsis_incrustans_M35_:0.037992):0.006648,(Magnaporthiopsis_maydis_CBS_133165:0.002502,_Magnaporthiopsis_maydis_CBS_662.82A:0.002534):0.039024):0.012677):0.086983,((Gaeumannomyces_sp._CPC_26284:0.043646,Falciphoriella_solaniterrestris_CBS_117.83:0.025997,Falciphoriella_oryzae_R561_:0.037569):0.01253,Buergenerula_spartinae_ATCC_22848:0.119255):0.013777):0.014455):0.036315,Nakataea_oryzae_CBS_252.34:0.086752):0.085944,Omnidemptus_affinis_ATCC_200212_:0.129699):0.042461,((((Gaeumannomycella_caricis_CBS_388.81:0.003879,Gaeumannomycella_caricis_26262:0.004219):0.17537,Slopeiomyces_cylindrosporus_CBS_609.75:0.104311):0.03259,(Gaeumannomyces_caricis_26245:0.069378,Kohlmeyeriopsis_medullaris_JK5528S:0.109363):0.057537):0.029831,Neogaeumannomyces_bambusicola_MFLUCC11_0390_:0.112598):0.029872):0.064994,Pseudophialophora_eragrostis_CM12m9:0.268443):0.092352,Bussabanomyces_longisporus_CBS_125232:0.277103):0.949976); [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr102083] END;