#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 22, 2021; 14:10 GMT TreeBASE (cc) 1994-2008 Study reference: Garfinkel A.R., Lorenzini M., Zapparoli G., & Chastagner G.A. 2017. Botrytis euroamericana, a new species from peony and grape in North America and Europe. Mycologia , . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21156] [ The following blocks are input data for analysis step 21039 ] BEGIN TAXA; TITLE TaxaForAnalysisStep21039; DIMENSIONS NTAX=43; TAXLABELS Botrytis_aclada_BA5 Botrytis_aclada_MUCL8415 Botrytis_byssoidea_MUCL94 Botrytis_californica_X503 Botrytis_calthae_MUCL2830 Botrytis_caroliniana_CB15 Botrytis_cinerea_HA08 Botrytis_cinerea_MS05 Botrytis_cinerea_MUCL87 Botrytis_convoluta_MUCL11595 Botrytis_croci_MUCL436 Botrytis_deweyae_CBS134649 Botrytis_elliptica_BE9714 Botrytis_eucalypti_CERC7170 Botrytis_euroamericana_AK10 Botrytis_euroamericana_B83 Botrytis_euroamericana_HA06 Botrytis_fabae_MUCL98 Botrytis_fabiopsis_BC2 Botrytis_ficariarum_MUCL376 Botrytis_fragariae_U14P1 Botrytis_galanthina_MUCL435 Botrytis_gladiolorum_MUCL3865 Botrytis_globosa_MUCL444 Botrytis_hyacinthi_MUCL442 Botrytis_narcissicola_MUCL2120 Botrytis_paeoniae_GBG22 Botrytis_paeoniae_HA11 Botrytis_paeoniae_MUCL16084 Botrytis_pelargonii_CBS497.50 Botrytis_polyblastis_CBS287.38 Botrytis_porri_MUCL3234 Botrytis_prunorum_Bpru1.9 Botrytis_pseudocinerea_10091 Botrytis_pyriformis_SedsarBC1 Botrytis_ranunculi_CBS178.63 Botrytis_sinoallii_OnionBC59 Botrytis_sinoviticola_GBC31c Botrytis_sphaerosperma_MUCL21481 Botrytis_squamosa_MUCL1107 Botrytis_tulipae_BT9830 Monilinia_fructigena_9201 Sclerotinia_sclerotiorum_484 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41526] TITLE Botrytis_euroamericana_G3PDH_individual_alignment; LINK TAXA = TaxaForAnalysisStep21039; DIMENSIONS NCHAR=876; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botrytis_aclada_BA5 TCGGACCTCCCGCACATTGT--AAGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAA--CATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_aclada_MUCL8415 TCGGACCTCCCGCACATTGT--AAGGACCCGAGCTAATCTATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACTTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTTACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGACGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTTATTCTGTTAATCTTTCTTCCGTCCTAATTTACTAATCGTAA--CATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_byssoidea_MUCL94 TCGGACCTCCCGCAGAGTTC--AAGGACTCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTTCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTTAGTTACTCTCTCAATCCTTCTTCCGTTCTAATTTATTAATCGCAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATTTTCGATGCCAAGGCC Botrytis_californica_X503 TCGGACCTCCCGCAGATATC--AAGGACCCGAGCTAATTCATATTATGTGCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATCGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCCGAGGGTCCTCTCAAGGGTAAGTTACCTTATTACTCTTTCTTCGGCTCTAATTTACTAATCGTAA--CACAGGCATTTTGGCTTACACTGAGGACGATGTCGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGACGCCAAGGCT Botrytis_calthae_MUCL2830 TCGGACCTCCCGCAGATATC--AAGGACCCGAGCTAATTTGTATTATGTGCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTCGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACTGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGCGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGCTACTCCATTACTCTTTCTTTGGCTCTAATTTACTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_caroliniana_CB15 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATTTATGTCACGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAGCTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTATTCTATTAATCTTTCTTCCGTTCTAATTTACTAATCGTGA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_cinerea_HA08 TCGGAGCTCCCGCAGATATC--AAGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_cinerea_MS05 TCGGAGCTCCCGCAGATATC--AAGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_cinerea_MUCL87 TCGGAGCTCCCGCAGATATC--AAGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_convoluta_MUCL11595 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTGATTTATTTTATCTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCTCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAATGCCTCCTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCGTTCTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAGGACGACGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_croci_MUCL436 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCCATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCTAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTCACTCTATCAATCCATCTTCTGTTACAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGATATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_deweyae_CBS134649 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATTGATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTCAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCGGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_elliptica_BE9714 TCGGACCTCCCACAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTATGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATTCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCGGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_eucalypti_CERC7170 TCGGAGCTCCCGCAGATATC--AAGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_euroamericana_AK10 TCGGACCTCCTGCAGATTTCA-AAGGACCCGAGCTAAT-TATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATCAATCTTTCTTCCGTTCTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAAGACGACGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_euroamericana_B83 TCGGACCTCCTGCAGATTTCA-AAGGACCCGAGCTAAT-TATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATCAATCTTTCTTCCGTTCTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAAGACGACGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_euroamericana_HA06 TCGGACCTCCTGCAGATTTCA-AAGGACCCGAGCTAAT-TATTCTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATCAATCTTTCTTCCGTTCTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAAGACGACGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_fabae_MUCL98 TCGGAGCTCCCGCAGATATC--AAGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTA----CTCTTCGGCTCTAATTTGCTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_fabiopsis_BC2 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATTTATGTCACGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAGCTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTATTCTATTAATCTTTCTTCCGTTCTAATTTACTAATCGTGA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_ficariarum_MUCL376 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAGGATGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_fragariae_U14P1 ---------------------------------------------------------ACATGTTGAAGTATGATTCTACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGACGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATATCTTTTCCATTTTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACCGAGGACGATGTTGTCTCTACTGACATGAACGGTGACAACCACTCCTCCATCTT------------- Botrytis_galanthina_MUCL435 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCAAAGTCACGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAATGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACTGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAGCTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTATTCTATTAATCTTTCTTCCGTTATAATTTACTAATCGTGA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_gladiolorum_MUCL3865 TCGGACCTCCCGCGGATTTC--AAGGACCCGAGCTAATTTGTACGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCCACCCTTCTCCCGTTCTAATTTACTAATCGCAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTTGATGCCAAGGCC Botrytis_globosa_MUCL444 TCGGACCTACCGCACATTTC--AAGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTCTCCGACGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACTGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATGATAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_hyacinthi_MUCL442 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCCATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCTAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTCACTCTATCAATCCATCTTCTGTTACAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGATATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_narcissicola_MUCL2120 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATTTGGATGATGTACAGGCATACATGCTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCTGTCATCAAGAAGGCCGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAACCACAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_paeoniae_GBG22 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACAAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCTCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTCTTTTCCATTTTAATTTACTAATCGTAA--TATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAATGGTGACAACAACTCCTCCATCTTCGATGCTAAGGCC Botrytis_paeoniae_HA11 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACAAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCTCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTCTTTTCCATTTTAATTTACTAATCGTAA--TATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAATGGTGACAACAACTCCTCCATCTTCGATGCTAAAACC Botrytis_paeoniae_MUCL16084 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACAAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCTCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTCTTTTCCATTTTAATTTACTAATCGTAA--TATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCCACTGACATGAATGGTGACAACAACTCCTCCATCTTCGATGCTAAGGCC Botrytis_pelargonii_CBS497.50 TCGGAGCTCCCGCAGATATC--AAGGACCCGAGCTAATTTATGTTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTCCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTACGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCCATTACTCTTTCTTCGGCTCTAATTTGCTAATCGTAA--CACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCT Botrytis_polyblastis_CBS287.38 TCGGACCTCCCGCACATTTC--AAGGACCCGAGCTAATTTGTATGATGTCCAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTCTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTAATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCCTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCCAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTGATCATAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_porri_MUCL3234 TCGGAGCTCCCGCAGATATT--ACGGACCCGAGCTAATTCGTATTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCATTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTTTCTTCCATTCTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_prunorum_Bpru1.9 TCGGACCTCCCGCAGATTGC--AAGGACCCGAGCTAATCTATCTTATGTACAGGCATACATGTTGAACTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGAAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAGGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAAAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTTACTCTATTAATCTCTTTTTCATTTCAATTTACTAATCGTAA--TATAGGCCTATTGGCTTACACTGAGGACGACGTTGTCTCCACAGACATGAACGGTGACAACCACTCCTCCATCTTCGATACTAAGGCC Botrytis_pseudocinerea_10091 TCGGACTTCCCGCAGATATT--ACGGACCCGAGCTAATTTATATTTTGCACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGACATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAGGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGACGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACTGGTGATGTTGATGTTATCACCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCTACCCAAAAGACCGTTGACGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGTGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATTAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAGGTTACTCCATCACTCTTTCTTTGGCTCTAATTTACTAATCATAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_pyriformis_SedsarBC1 CCGGAGCTCCCGCAGATATC--AATGACCCGTACTAATCTATATTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGATCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCCGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCTATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTAAGTGACTCTATCAATCTTTCTTCGGTTCTAACTTACTAATCGTAA--CATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTAACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_ranunculi_CBS178.63 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTATTATTTCTTCCGTTTTAATTTACTAATCGTAA--TGTAGGTATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_sinoallii_OnionBC59 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGCACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGCTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACTGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTTATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTCCCGTTTTAATTTACTAATCGTAA--TATAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACACGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_sinoviticola_GBC31c TCGGACCTCCCGCAGATGTC--AAGGACCCGAGCTAATCTATATTATGTGCAGGCATACATGTTGAAGTATGATTCTACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTGCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTCGTCGAGTCCGCCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCATCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCTGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATTAAGGCCGTCATCAAGAAGGCTGCCGATGGTCCTCTCAAGGGTAAGTCACTCTATCACTCTTTCTTCGGCTCTAATTTACTAATCGTAA--CACAGGCATTTTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCTAAGGCT Botrytis_sphaerosperma_MUCL21481 TCGGACCTACCGCAGATTTC--AAGGACCCGAGCTAATTTGTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATCCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACTGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTTAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATGATAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_squamosa_MUCL1107 TCGGACCTCCCGCAGATTTC--AAGGACCCGAGCTAATCTATTTTATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAAAGAGACCCAGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCCCATTTGAAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTCGATGGTCCATCTGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTTATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTATTAATATTTCTTCCGTTTTAATTTACTAATCGTAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Botrytis_tulipae_BT9830 TCGGACCTCCCGCTGATTTC--AAGGACCCGAGCTAATTTTTATGATGTACAGGCATACATGTTGAAGTATGATTCCACCCACGGTCAATTCAAGGGTGATATCAAGGTCCTTTCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACCGAGAGAGACCCAGCCAACATCCCATGGGCTGAGTCCGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCGCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACAAGGGTGATGTTGATGTTATCTCCAACGCCTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAATTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACCGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAACTCACCGGAATGTCCATGCGTGTTCCAACTGCCAACGTCTCAGTTGTTGACTTGACTGTCCGCATTGAGAAGGGTGCTTCTTATGATGAGATCAAGGCCGTCATCAAGAAGGCTGCTGATGGTCCTCTCAAGGGTGAGTTACTCTCTCAACCCTTCTTCCGTTCTAATTTACTAATCATAA--TACAGGCATATTGGCTTACACTGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Monilinia_fructigena_9201 CCGGACCTCCCGCATATACCCTCAGAACCCGAGCTAATCCTTTTTCTTTGCAGGCATACATGTTGAAGTATGACTCCACCCACGGTCAATTCAAGGGTGATGTCAAGGTCCTCCCCGATGGATTGGAGGTCAATGGCAAGAAGGTCAAGTTCTACACTGAGAGAGACCCTGCCAACATTCCATGGGCTGAGTCTGAGGCATACTACGTTGTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCCGATGCCCCAATGTACGTTATGGGTGTCAACAACGAGACCTACACGGGTGACGCTGATGTCATCTCCAACGCTTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATCGAGGGTTTGATGACCACCATCCACTCCTACACTGCCACCCAAAAGACCGTTGATGGTCCATCCGCCAAGGACTGGCGTGGAGGACGTACCGCTGCTCAAAACATTATCCCATCGAGCACCGGTGCTGCCAAGGCCGTCGGAAAGGTCATCCCAGAGCTTAACGGCAAGCTCACCGGAATGGCCATGCGTGTCCCAACTGCCAACGTCTCCGTTGTTGACTTGACCTGCCGCATTGAGAAGGGTGCTACTTATGAAGAGATCAAGGCTGTCGTCAAGAAGGCTGCTGAGGGTCCTCTCAAGGGTATG-AGCTTTCATAATCTTTTATGCTTTCCAGATTACTAACAGTGATATATAGGCATATTGGGTTACACTGAGGACGATGTTGTCTCTACTGATTTGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC Sclerotinia_sclerotiorum_484 TCGGACCTCCCAATGACACC--AAGGACCCGAGCTAATTTTTATCCTTCACAGGCATACATGTTGAAATATGACTCCACTCACGGTCAATTCAAGGGTGATATCAAAGTCCTCTCCGACGGATTGGAGGTTAATGGCAAGAAAGTCAAGTTCTACACTGAGAGAGACCCTGCCAACATCCCATGGGCTGAGTCTGAGGCATACTACGTTCTCGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCTAAGGCACATTTGAAGGGTGGTGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCAATGTACGTCATGGGTGTCAACAACGAGACCTACAATGGTGAAGCAGATGTTATCTCCAACGCTTCTTGCACAACCAACTGCTTGGCTCCTCTCGCCAAGGTCATCAACGATGAGTTCACCATCATTGAAGGTTTGATGACCACCATTCACTCCTACACTGCCACCCAAAAGACCGTTGATGGTCCATCCGCTAAGGATTGGCGTGGAGGACGTACCGCTGCTCAAAACATCATTCCATCGAGCACCGGTGCCGCCAAGGCCGTCGGAAAGGTCATTCCAGAGCTTAACGGCAAGCTCACCGGAATGTCTATGCGTGTTCCAACTGCCAACGTCTCTGTTGTTGACTTGACTGTCCGCATTGAGAAGGCTGCTTCTTATGATGAGATCAAGGAGGTCATCAAGAAGGCCGCCAATGGTCCTCTCAAGGGTAAG-AAATTTGTCAATATTCATTACTTTTCAATTTACTAACAGCAATGTATAGGCATATTGGCTTACACCGAGGACGATGTTGTCTCCACTGACATGAACGGTGACAACCACTCCTCCATCTTCGATGCCAAGGCC ; END; [ The following blocks are output data for analysis step 21039 ] BEGIN TREES; TITLE Botrytis_euroamericana_G3PDH; LINK TAXA = TaxaForAnalysisStep21039; TREE Imported_tree_1 = [&R] ((((((((((((Botrytis_cinerea_HA08:0.0,Botrytis_cinerea_MS05:0.0)0.1700:0.0,Botrytis_cinerea_MUCL87:0.0)0.0760:0.0,(Botrytis_eucalypti_CERC7170:0.0,Botrytis_pelargonii_CBS497.50:0.0)0.1880:0.0)0.9770:0.00211755,Botrytis_fabae_MUCL98:0.00145093)0.9410:0.00592902,Botrytis_pseudocinerea_10091:0.01853303)0.9810:0.00902526,(Botrytis_calthae_MUCL2830:0.00950239,(Botrytis_californica_X503:0.00878122,Botrytis_sinoviticola_GBC31c:0.01234063)0.7410:0.00254806)0.5270:0.00131194)0.9820:0.00900366,Botrytis_pyriformis_SedsarBC1:0.0164039)0.8480:0.00491649,Botrytis_porri_MUCL3234:0.01072713)0.3410:0.00269121,(Botrytis_prunorum_Bpru1.9:0.0147318,(Botrytis_fragariae_U14P1:0.00995869,(Botrytis_paeoniae_MUCL16084:0.0,(Botrytis_paeoniae_GBG22:0.0,Botrytis_paeoniae_HA11:0.00235102)0.0760:0.0)0.9990:0.00729876)0.1130:0.0)0.5270:0.00708799)0.0070:0.0,(Botrytis_convoluta_MUCL11595:0.00858634,(Botrytis_euroamericana_AK10:0.0,(Botrytis_euroamericana_B83:0.0,Botrytis_euroamericana_HA06:0.0)0.3370:0.0)1.0000:0.00735274)0.4350:9.8761E-4)0.0170:0.00100757,((Botrytis_aclada_BA5:0.0,Botrytis_aclada_MUCL8415:0.0)1.0000:0.01745898,((((((Botrytis_globosa_MUCL444:0.00477608,Botrytis_sphaerosperma_MUCL21481:0.0)0.8190:0.00478499,Botrytis_polyblastis_CBS287.38:0.00851417)0.5270:0.0,Botrytis_tulipae_BT9830:0.00720201)0.3130:0.00230905,(Botrytis_gladiolorum_MUCL3865:0.00724004,(Botrytis_byssoidea_MUCL94:0.00848078,Botrytis_narcissicola_MUCL2120:0.00965147)0.1180:0.0)0.7130:0.00362762)0.9880:0.01037131,(Botrytis_croci_MUCL436:0.0,Botrytis_hyacinthi_MUCL442:0.0)1.0000:0.0139064)0.5210:0.00217278,(((Botrytis_caroliniana_CB15:0.0,Botrytis_fabiopsis_BC2:0.0)0.8090:0.0,Botrytis_galanthina_MUCL435:0.00603418)1.0000:0.01267775,(Botrytis_ranunculi_CBS178.63:0.00372632,(Botrytis_ficariarum_MUCL376:0.00216493,(Botrytis_sinoallii_OnionBC59:0.00852308,(Botrytis_squamosa_MUCL1107:0.00135677,(Botrytis_deweyae_CBS134649:0.0048049,Botrytis_elliptica_BE9714:0.00357615)0.7490:0.00218445)0.4220:0.00117008)0.1050:0.0)0.4960:0.0011984)0.9620:0.00600663)0.4390:0.00208404)0.3690:0.00241498)0.0380:0.0)0.9740:0.02630823,(Monilinia_fructigena_9201:0.06792488,Sclerotinia_sclerotiorum_484:0.06264962)0.9740:0.00356058); [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr105256] END;