#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on June 22, 2021; 14:06 GMT TreeBASE (cc) 1994-2008 Study reference: Garfinkel A.R., Lorenzini M., Zapparoli G., & Chastagner G.A. 2017. Botrytis euroamericana, a new species from peony and grape in North America and Europe. Mycologia , . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S21156] [ The following blocks are input data for analysis step 21043 ] BEGIN TAXA; TITLE TaxaForAnalysisStep21043; DIMENSIONS NTAX=34; TAXLABELS Botrytis_aclada_BA5 Botrytis_aclada_MUCL8415 Botrytis_byssoidea_MUCL94 Botrytis_calthae_MUCL2830 Botrytis_cinerea_BcB Botrytis_cinerea_HA08 Botrytis_cinerea_MS05 Botrytis_convoluta_MUCL11595 Botrytis_croci_MUCL436 Botrytis_deweyae_CBS134649 Botrytis_elliptica_BE9714 Botrytis_eucalypti_CERC7170 Botrytis_euroamericana_AK10 Botrytis_euroamericana_B83 Botrytis_euroamericana_HA06 Botrytis_fabae_MUCL98 Botrytis_ficariarum_CBS176.63 Botrytis_fragariae_U14P1 Botrytis_galanthina_MUCL3204 Botrytis_gladiolorum_9701 Botrytis_globosa_MUCL21514 Botrytis_hyacinthi_0001 Botrytis_narcissicola_MUCL2120 Botrytis_paeoniae_0003 Botrytis_paeoniae_GBG22 Botrytis_paeoniae_HA11 Botrytis_pelargonii_MUCL1152 Botrytis_polyblastis_CBS287.38 Botrytis_porri_MUCL3234 Botrytis_prunorum_Bpru1.9 Botrytis_ranunculi_CBS178.63 Botrytis_sphaerosperma_MUCL21481 Botrytis_squamosa_MUCL1107 Botrytis_tulipae_BT9830 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M41530] TITLE Botrytis_euroamericana_NEP1_individual_alignment; LINK TAXA = TaxaForAnalysisStep21043; DIMENSIONS NCHAR=693; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botrytis_aclada_BA5 GAGAACACCATCCAAGCACGCGCCGTCGTTCCTCATGATTCGATCAACCCATGGGGAGAGAACGTACCTGGCAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTTCACATTGCCCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAGAACTACTATTTCCTTTCCCTTCGGATATCGC-TTTACTAACACGTTTTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGCCGTGATCAGGCCAAGGGTCAAACCTATGTCAGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGCATCCTCTTCATCGTCTCCCACTCATATCACACTTTCTAACCTTCCCCAGATTTCCCCAAGGATCAACCAGCAGCCGGAAACGTCGTTGGAGGTCACCGTCACGACTGGGAGCACATCGTCGTCTGGGTCAACAACCCCTCTATCGCTAACCCCACTTTAATCGGTGCCGCCGCATCTGGTCACGGAAGTGTCAAGAAGACAACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAATACCCTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_aclada_MUCL8415 GAGAACACCATCCAAGCACGCGCCGTCGTTCCTCATGATTCGATCAACCCATGGGGAGAGAACGTACCTGGCAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTTCACATTGCCCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAGAACTACTATTTCCTTTCCCTTCGGATATCGC-TTTACTAACACGTTTTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGCCGTGATCAGGCCAAGGGTCAAACCTATGTCAGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGCATCCTCTTCATCGTCTCCCACTCATATCACACTTTCTAACCTTCCCCAGATTTCCCCAAGGATCAACCAGCAGCCGGAAACGTCGTTGGAGGTCACCGTCACGACTGGGAGCACATCGTCGTCTGGGTCAACAACCCCTCTATCGCTAACCCCACTTTAATCGGTGCCGCCGCATCTGGTCACGGAAGTGTCAAGAAGACAACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAATACCCTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_byssoidea_MUCL94 GAGAACACCATCCAAGCTCGTGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAAATACTTTTTCCTTTCCCTTCTAATATCTC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCGTGGTGTAAGTATCCCATCCATTCT-CTCCACTCTTTTCATACCTTCTAACCCATTTCAGATTTTCCCAAGGATCAACCAGCAGCTGGAAACGTCGTTGGAGGCCATCGTCACGACTGGGAGTACGTCGTCGCCTGGGTCAACAACCCTTCCGTCGCCAACCCCTCCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_calthae_MUCL2830 GAGAACACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAAATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCATACAGTGCCGTTGATGGTTATGGTAACACCAGGTATGAAAACTACTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACATTCTGCAGTGGTGGGCTCCAAGATACTGGCAATATCTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTCACACTTTCTAACCCTCCCCAGATTTCCCCAAGGATCAACCAGCTGCCGGAAACGTCATCGGAGGTCATCGTCACGACTGGGAGTACGTCGTCGCCTGGGTCAACAACCCCTCGGTTGCCAACCCCACCTTAATCGGCGCCGGTGCATCCGGCCACGGAAGCATCAAGAAGACCACAAATCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCCTTCCCAACTAACCACGAGTTGCAATTCACCAACAGCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_cinerea_BcB GAGAGCACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCATACAGTGCCGTTGATGGTAATGGTAACACCAGGTATGAAAACTGTTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTTACACTTTCTAACCCTCCCCAGACTTCCCCAAGGATCAACCAGCCGCCGGAAACGTCGTCGGAGGTCACCGTCATGACTGGGAGTATGTCGTCGCTTGGGTCAACAACCCCGAGGTTGCCAACCCCACCTTAATCGGCGCCGGCGCATCCGGTCACGGAAGCATCAAGAAGACCACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCCTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_cinerea_HA08 GAGAGCACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCATACAGTGCCGTTGATGGTTATGGTAACACCAGGTATGAAAACTACTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACTTTCTGCAGTGGTGGGCTTCAAGACACTGGCAATGTTTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTTACACTTTCTAACCCTCCCCAGACTTCCCCAAGGATCAACCAGCCGCCGGAAACGTCGTCGGAGGTCACCGTCACGACTGGGAGTATGTCGTCGCTTGGGTCAACAACCCCGAGGTTGCCAACCCCACCTTAATCGGCGCCGGCGCATCCGGTCACGGAAGCATCAAGAAGACCACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCCTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_cinerea_MS05 GAGAGCACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCATACAGTGCCGTTGATGGTAATGGTAACACCAGGTATGAAAACTGTTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTTACACTTTCTAACCCTCCCCAGACTTCCCCAAGGATCAACCAGCCGCTGGAAACGTCGTCGGAGGTCACCGTCACGACTGGGAGTATGTCGTCGCTTGGGTCAACAACCCCGAGGTTGCCAACCCCACCTTAATCGGCGCCGGCGCATCCGGTCACGGAAGCATCAAGAAGACCACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCCTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_convoluta_MUCL11595 GAGAGCACAATCCAAGCTCGCGCCGACGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAAATTCGAGCCATTCATTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAACTACTATTTCCTTTCCCTTCTGATATCAC-TTTACTAACATATCTTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAAGGTCAAACCTATGTCCGTGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCTTGGTGTAAGTATCACCTTTATCCCCTCCCACTCATCTCACACCTTCTGACCCTCCCCAGATTTCCCCAAGGATCAACCCGCCGCCGGAAACGTCGTCGGAGGTCATCGTCACGACTGGGAGCACGTCGTCGTCTGGGTCAACAACCCTTCCGTTGCCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAGGTCTCAAGAAAACGACAAATCCCCAACGCCAGGGCGATAGATTGAAGGTCGAATACTATGTCACTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_croci_MUCL436 GAGAACACCATCCAAGCTCGTGCCGTCGTTCCTCATGACTCCATTAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTCGATGGTAATGGTAACACTAGGTATGAAACTTACTTTTTCCTTTCCCTTCTAATATCAC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGTCGTGATCAGAGCAAAGGTCAAACCTACGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATACCATCCATTCT-CTCCACTCTTTTCATACCTTCTAACCCTCTTCAGATTTCCCCAAGGATCAACCAGCAGCCGGAAACGTTGTTGGAGGCCATCGTCACGACTGGGAGCACATCGTCGTCTGGGTCAACAACCCTGAAGTCGGCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAACCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCTACCAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_deweyae_CBS134649 GAGAACACTATTCAAGCTCGTGCCGTCGTTGATCATGACTCTATCAATCCATGGCCAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCGGTTGATGGTTATGGAAATACCAGGTATGAAAACTACTTTTTCCTTTCCCTTCTGATATCGC-TTTACTAACACATTCTGTAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGTTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCAGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATATACGCCTGGTGTAAGTATCTCCCCCATTCTCCCCCACTCATTTCACACCTTCTAACCCTTTTCAGATTTCCCCAAGGATCAACCAGCGGCTGGAAACGTCGTCGGAGGCCATCGTCACGACTGGGAGTACATCGTCGTCTGGGTCAACAACCCTTCCGTCGCCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAATCACGAGTTGCAGTTCACCGACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_elliptica_BE9714 GAGAACACTATTCAAGCTCGTGCCGTCGTTAATCATGACTCTATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCGGTTGATGGTTATGGAAATACCAGGTATGAAAACTACTTTTTCCTTTCCCTTCTGATATCGC-TTTACTAACACATTCTGTAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGTTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCAGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCTCCCCCATTCTCCCCCACCCATTTCACACCTTCTAACCCTTTTCAGATTTCCCCAAGGATCAACCAGCGGCTGGAAACGTTGTTGGAGGCCATCGTCACGACTGGGAGCACATCGTCGTCTGGGTCAACAACCCTTCCGTCGCCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAATTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_eucalypti_CERC7170 GAGAGCACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCATACAGTGCCGTTGATGGTAATGGTAACACCAGGTATGAAAACTGTTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTTACACTTTCTAACCCTCCCCAGACTTCCCCAAGGATCAACCAGCCGCCGGAAACGTCGTCGGAGGTCACCGTCACGACTGGGAGTATGTCGTCGCTTGGGTCAACAACCCCGAGGTTGCCAACCCCACCTTAATCGGCGCCGGCGCATCCGGTCACGGAAGCATCAAGAAGACCACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCCTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_euroamericana_AK10 GAGAACACCCTCCAAGCTCGCAACGTCGTTCCTCATGATTCGATCAACCCATGGGGAGAAAACGTACCTGGCAACGCCTTGGGTAACACCTTGAAGAAATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTCATGGTAACACCAGGTATGAATAC-ACTACTTCCTTTCCCTTCTGATATCAC-TTTGCTAACACATTTTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGTTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTATGCCTGGTGTAAGTATCCCCTTCATCCCCTCTCACTCATCTCACACCTTCTAACCTTCCCCAGATTTCCCTAAGGATCAACCAGCAGCCGGAAACGTCGTTGGAGGTCATCGTCACGATTGGGAGCACGTCGTCGTCTGGGTCAACAACCCGGAGGTCGCCAACCCCACTTTAATCGGTGCCGCCGCATCTGGTCACGGAAGTCTCAAGAAGACGACAAATCCCCAACGCCAAGGTGATCGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCCTGGGTAGAGACTTGCCAATGATGTGGTGGGACTTCTTGCCACAGGTCAGCAAG Botrytis_euroamericana_B83 GAGAACACCCTCCAAGCTCGCAACGTCGTTCCTCATGATTCGATCAACCCATGGGGAGAAAACGTACCTGGCAACGCCTTGGGTAACACCTTGAAGAAATTTGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTCATGGTAACACCAGGTATGAATAC-ACTACTTCCTTTCCCTTCTGATATCAC--TTGCTAACACATTTTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGTTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTATGCCTGGTGTAAGTATCCCCTTCATCCCCTCTCACTCATCTCACACCTTCTAACCTTCCCCAGATTTCCCTAAGGATCAACC-GCAGCCGGAAACGTCGTTGGAGGTCATCGTCACGATTGGGAGCACGTCGTCGTCTGGGTCAACAACCCGGAGGTCGCCAACCCCACTTTAATCGGTGCCGCCGCATCTGGTCACGGAAGTCTCAAGAAGACGACAAATCCCCAACGCCAAGGTGATCGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCCTGGGTAGAGACTTGCCAATGATGTGGTGGGACTTCTTGCCACAGGTCAGCAAG Botrytis_euroamericana_HA06 GAGAACACCCTCCAAGCTCGCAACGTCGTTCCTCATGATTCGATCAACCCATGGGGAGAAAACGTACCTGGCAACGCCTTGGGTAACACCTTGAAGAAATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTCATGGTAACACCAGGTATGAATAC-ACTACTTCCTTTCCCTTCTGATATCAC-TTTGCTAACACATTTTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGTTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTATGCCTGGTGTAAGTATCCCCTTCATCCCCTCTCACTCATCTCACACCTTCTAACCTTCCCCAGATTTCCCTAAGGATCAACCAGCAGCCGGAAACGTCGTTGGAGGTCATCGTCACGATTGGGAGCACGTCGTCGTCTGGGTCAACAACCCGGAGGTCGCCAACCCCACTTTAATCGGTGCCGCCGCATCTGGTCACGGAAGTCTCAAGAAGACGACAAATCCCCAACGCCAAGGTGATCGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCCTGGGTAGAGACTTGCCAATGATGTGGTGGGACTTCTTGCCACAGGTCAGCAAG Botrytis_fabae_MUCL98 GAGAGCACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCGTACAGTGCCGTTGATGGTAATGGTAACACCAGGTATGAAAACTGCTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAGACCTATGTCCGAGGTGGCTGGTCTGGGGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTTACACTTTCTAACCCTCCCCAGACTTCCCCAAGGATCAACCAGCCGCCGGAAACGTCGCCGGAGGTCACCGTCACGACTGGGAGTACGTCATCGCTTGGGTTAACAACCCCGAGGTTGCCAACCCCACCTTAATCGGCGCCGGCGCATCCGGTCACGGAAGCATCAAGTTGACCACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTTTGTCTCCTTCCCAACCAATCACGAGTTGCAGTTTACCGACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_ficariarum_CBS176.63 GAGAACACCATCCAAGCTCGTGCCGTCGTTAATCATGACTCTATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGAAATACCAGGTATGAAA---ACTTTTTCCTTTCCATTCTGATATCGC-TTTACTAATACATTCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCTCCCCCATTCTCCCCCACTCATTTCACACCTTCTAACCCTTTTCAGATTTCCCCAAGGATCAACCAGCGGCTGGAAACGTCGTTGGAGGCCATCGTCACGACTGGGAGCACATCGTTGTTTGGGTCAACAACCCTAACGTGGGCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_fragariae_U14P1 ------------------------------------GATTCGATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAAATTCGAGCCATTCATCCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGCAACACCAGGTATGAAAACTACTTATTCCTCTCCCTTCTAATATCGC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAAGGTCAAACCTATGTCCGAGGTGGCTGGTCTGGAAGTCGCTATGGTATCATGTACGCCTGGTGTAAGTGTCCCCTCCATCTCCACCCACTTATCTCACACCTTCTAACACTCCCCAGATTTCCCCAAGGATCAACCTGCAGCCGGAAACGTCGTCGGAGGTCATCGTCACGACTGGGAGCACGTCGTCGTCTGGGTCAACAACCCTACCGTCGCCAACCCCACCTTAATCGGTGCCGCCGCATCTGGCCACGGAAGTCTCAAGAAAACGACAAATCCCCAACGCCAGGGCAATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGAAGTTAGCAAG Botrytis_galanthina_MUCL3204 GAGAACACCATTCAAGCTCGTGCCGACATTGATCATGACTCCATTAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTTATGGTAACACCAGGTATGAAAACTACTTTTTCCTCCCCCTTCTAATATCAC-TCTACTAACACATCCTGCAGTGGTGGTCTCCAAGATACTGGAAATGTCTCAGCCAGCTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCCGAGGTGGCTGGTCCGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCCTCCATTCTTTTCCGCTCATTTCGCACCTTCTAACCTTTTTCAGATTTCCCCAAGGATCAGCCAACAGCCGGAAATGTTATCGGAGGCCATCGTCACGACTGGGAATACATCGTCGTCTGGGTCAACAACCCTGAAGTCGGCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCGACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_gladiolorum_9701 GAGAACACCATCCAAGCTCGTGCCGTTGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAAAAATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAATACCAGGTATGAAAAACACTTTTCCCTTTCTCTTCTAATGTCGC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGCCATGATCAGAGCAAGGGTCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTGTCCCATCCATTCT-CTCCACTCTTTTCATACCTTCTAACCCATTTCAGATTTCCCCAAGGATCAACCAGCAGCTGGAAACCTCGTTGGAGGCCATCGTCACGACTGGGAGTGCGTCGTTGCCTGGGTCAACAACCCTTCCGTCGTTAACCCCTCCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCCGCTGTTAGCAAG Botrytis_globosa_MUCL21514 GAGAACACAATCCAAGCTCGTGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTTCACATCGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAAATACTTTCTTCTTTCCCTTCTAATATCGC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAACCGGCTACCGTGATCAGAGCAAGGGTCGAACCTATGTCCGAGGTGGCTCGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCATCTGTTCT-CTCCACTCAT-TCATACCTTCTAACCCTCTTCAGATTTCCCCAAGGATCAACCAGCAGCTGGAAACGTCGTTGGAGGCCATCGCTACGACTGAGAGTACGTCATCGCCTGGATCAACAACCCTTCCGTCGCTGGCCCCGCCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCTAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCGCAATCAACCACGAGTTGCAGTTCACCAAAACATTGGTCAGAGACTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_hyacinthi_0001 GAGAACACCATCCAAGCTCGTGCCGTCGTTCCTCATGACTCCATTAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTCGATGGTAATGGTAACACTAGGTATGAAACTTACTTTTTCCTTTCCCTTCTAATATCAC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGTCGTGATCAGAGCAAAGGTCAAACCTACGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATACCATCCATTCT-CTCCACTCTTTTCATACCTTCTAACCCTCTTCAGATTTCCCCAAGGATCAACCAGCAGCCGGAAACGTTGTTGGAGGCCATCGTCACGACTGGGAGCACATCGTCGTCTGGGTCAACAACCCTGAAGTCGGCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAACCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCTACCAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_narcissicola_MUCL2120 GAGAACACAATCCAAGCTCGTGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAAATTTGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTTATGGTAACACCAGGTATGAAA-TTAGTTTTTCCTTTACCTTCTAATATCGC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGACTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCATCCATTCT-CTCCACTCTCTTCATACTTTCTAACCCATTTCAGATTTCCCCAAGGATCAACCAGCAGCTGGAAACGTCATTGGAGGCCATCGTCACGACTGGGAGTACGTCGTCGCCTGGGTCAACAACCCTTCCGTCGCTAACCCCTCCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACATTAGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_paeoniae_0003 GAGAGCACCATCCAAGCTCGCGCTACAGTCCCTCACGATTCGATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCGTGGGTAACACCTTGAAGAGATTTGAGCCATTCATTCGCATTGCTCATGGTTGCCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAACTACTTATTCCTTTCC-TTCTAATATCGCTTTTACTGATACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCGGTGATCTAAGCAAAGGTCAAACCTATGTCCGAGCTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCATTCATCTCCACCCACTCATCTCACACCTTCTAACTCTCCCCAGATTTCCCCAAGGATCAACCCGCATCCGGAAACGTCGTTGGAGGTCATCGTCACGACTGGGAGCACGTCGTCGTCTGGGTCAACAACCCCGCCCTCCCCAACCCCACCTTAATCGGTGCCGCCGCATCTGGCCACGGAAGTCTCAAGAAAACGACAAATCCCCAACGCCAGGGCGATAGAGTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCGACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGCCAGCAAG Botrytis_paeoniae_GBG22 GAGAGCACCATCCAAGCTCGCGCTACAGTCCCTCACGATTCGATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCGTGGGTAACACCTTGAAGAGATTTGAGCCATTCATTCGCATTGCTCATGGTTGCCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAACTACTTATTCCTTTCC-TTCTAATATCGCTTTTACTGATACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCGGTGATCTAAGCAAAGGTCAAACCTATGTCCGAGCTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCATTCATCTCCACCCACTCATCTCACACCTTCTAACTCTCCCCAGATTTCCCCAAGGATCAACCCGCATCCGGAAACGTCGTTGGAGGTCATCGTCACGACTGGGAGCACGTCGTCGTCTGGGTCAACAACCCCGCCCTCCCCAACCCCACCTTAATCGGTGCCGCCGCATCTGGCCACGGAAGTCTCAAGAAAACGACAAATCCCCAACGCCAGGGCGATAGAGTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCGACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGCCAGCAAG Botrytis_paeoniae_HA11 GAGAGCACCATTCAAGCTCGCGCTACAGTCCCTCACGATTCGATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCGTGGGTAACACCTTGAAGAGATTTGAGCCATTCATTCGCATTGCTCATGGTTGCCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAACTACTTATTCCTTTCC-TTCTAATATCGCTTTTACTGATACATCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCGGTGATCTAAGCAAAGGTCAAACCTATGTCCGAGCTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCATTCATCTCCACCCACTCATCTCACACCTTCTAACTCTCCCCAGATTTCCCCAAGGATCAACCCGCATCCGGAAACGTCGTTGGAGGTCATCGTCACGACTGGGAGCACGTCGTCGTCTGGGTCAACAACCCCGCCCTCCCCAACCCCACCTTAATCGGTGCCGCCGCATCTGGCCACGGAAGTCTCAAGAAAACGACAAATCCCCAACGCCAGGGCGATAGAGTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCGACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGCCAGCAAG Botrytis_pelargonii_MUCL1152 GAGAGCACCATTCAAGCTCGCGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACCTTGAAGAGATTCGAGCCATATCTTCACATTGCTCATGGTTGTCAACCATACAGTGCCGTTGATGGTAATGGTAACGCCAGGTATGAAAACTACTTTTTTCTTCCCCTTTTAATATCGC-TTTACTAACACACCCTGCAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGAATCATGTACGCCTGGTGTAAGTATCCCTTTCATCCCCTCCCACTCATCTTACACTTTCTAACCCTCCCCAGACTTCCCCAAGGATCAACCAGCCGCTGGAAACGTCGTCGGAGGTCACCGTCACGACTGGGAGTATGTCGTCGCTTGGGTCAACAACCCCGAGGTTGCCAACCCCACCTTAATCGGCGCCGGCGCATCCGGTCACGGAAGCATCAAGAAGACCACAAACCCCCAACGCCAGGGCGACAGATTGAAGGTCGAATACTATGTCTCCTTCCCAACCAACCACGAGTTGCAGTTCACCAACACCTTGGGCAGAGATTTGCCAATGATGTGGTATGACTTCTTGCCAGCTGTTAGCAAG Botrytis_polyblastis_CBS287.38 GAGAACACCATCCAGGCTCGTGCCGTCATTGGTCATGACTCCATCAACCCATGGCCAGAAAACGTACCTGGTAACGCCGTGGGTAACACTTTGAAGAAATTCGAGCCATTCATTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTTATGGTAACACCAGGTATGAAAATTACTTTTTCCTTTCCCTTCTAATGTCAC-TTTACTAATACACCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAAGGTCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACTCCTGGTGTAAGTATCCCATCTATTCT-CTCCACTC-TTTCATACCTTCTAACCCTCTTCAGATTTCCCCAAGGATCAACCAATAGCTGGAAACGTCGCTGGAGGCCATCGTCACGACTGGGAGTTCGTCGTCGTCTGGGTCAACAACCCTGCCGTCGCTAACCCCACCTTGATCGGTGCCGCCGCATCTTCTCACGGAAATTTGAGGAAGACGACCAATCCCCAACGCCAGGGTAATAGAGTGAAGGTCGAATACTTTACCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCGACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCGGGTGTTAGCAAG Botrytis_porri_MUCL3234 GAGAACACCATTCAAGCTCGCGCGGTCGTTTCTCACGATTCAATCAACCCATGGCCAGAAAACGTTCCTGGTAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTCCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGATACGGTAACACCAGGTACGAAACT---CCTTTTCTCTCCCTTCTAATATCAC-TTTACTAACGCATCCTACAGTGGTGGACTCCAAGACTCAGGTAGCCCTTCAGGCGGTTGCCGTGATCAGAGCAAGGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCTTCATCAT----CCCCATGCATCTCACACAATCTAACCCTCCCCAGACTTCCCTAAAGATCAGCCCATCCCCGGAAACGTCGTTGGAGGCCATCGTCACGACTGGGAGCACGTTGTCGTCTGGGTTAACAACCCTTCCGTCGCCAACCCTGTCTTAATCGGCGCCGGTGCATCCGGTCACGGAAAGATGAAGAAAACCACAAACCCCCAACGCCAGGGCGATAGAGTCAAGGTGGAATACTTCACCACTTTCCCTACCAACCACGAGTTGCAGTTCACCGATACTTTGGGCAGAGATTTACCAATGATGTGGTATGACTTCTTGCCAGCTGCTAGCAAG Botrytis_prunorum_Bpru1.9 GAGAGCACCATCCAAGCTCGCGCTGTAGTCCCTCACGATTCGATCAACCCATGGGGAGAAAACGTACCTGGCAACGCCTTGGGTAACACCTTGAAGAAATTTGAGCCATTCATTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGATACGGTAACACCAGGTATGAAACT---CCTTTTCTTTCCCTTTTAAAATCAC-TTTACTAACGCATCCTGCAGTGGTGGACTCCAAGACACAGGTAACCCCTCAGCTGGTTGCCGTGATCAAAGCAAAGGCCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGT-------CCCTTCTTCCCCATGCATTTCACACATTCTAACCCTCCCCAGATTTCCCCAAGGATCAACCCATCGCCGGAAACGTCGCTGGAGGTCATCGTCATGACTGGGAGCACGTCGTCGTCTGGGTTAACAACCCATCCGTCGCC-ACCCCACCTTAATCGGTGCCGGTGCATCAGGTCACGGAAAAATGAAGAAAACCACAAACCCTCAACGCCAGGGCGACAGAGTGAAGGTTGAATACTATACCACGTTCCCTACCGACCACGAGCTGCAGTTCACAGATACCTTGGGCAGAGATTTACCAATGATGTGGTATGACTTCTTGCCAGCTGCTAGCAAG Botrytis_ranunculi_CBS178.63 GAGAACACCATCCAAGCTCGTGCCGTCGTTAATCATGACTCTATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGAAATACCAGGTATGAAAACTACTTTTTCCTTTCCCTTCTGATATCGC-TTTACTAACACATTCTGTAGTGGTGGACTCCAAGATACTGGCAATGTCTCAGCCGGTTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCAGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCTCCCCCATTCTCCCCCACTCATTTCACACCTTCTAACCCTTTTCAGATTTCCCCAAGGATCAACCAGCGGCTGGAAACGTCGTTGGAGGCCATCGTCACGACTGGGAGCACATCGTAGTTTGGGTCAACAACCCTAACGTCGGCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACAAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_sphaerosperma_MUCL21481 GAGAACACAATCCAAGCTCGAGCCGTCGTTCCTCATGACTCCATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAAATTCGAGCCATTCCTTCACATCGCTCTTGGTTGTCAACCATACAGTGCAGTTGATGGTAATGGTAACACCAGGTATGAAAAATACTTTCTTCTTTCCCTTCTAATATCGC-TTTACTAATACATCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAAACGGCTACCGTGATCAGAGCAAGGGTCGAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCTATCTGTTCT-CTCCACTCAT-TCATACCTTCTAACCCTCTTCAGATTTCCCCAAGGATCAACCAGCAGCTGGAAACGTCGTTGGAGGCCATCGCTACGACTGAGAGTACGTCATCGCCTGGATCAACAACCCTTCCGTCGCTGGCCCCGCCTTGACCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCTAACGCCAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCGCAACCAACCACGAGTTGCAGTTCACCAAAACATTGGTCAGAGACTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_squamosa_MUCL1107 GAGAACACTATTCAAGCTCGTGCCGTCGTTAATCATGACTCTATCAACCCATGGGGAGAAAACGTACCTGGTAACGCCTTGGGTAACACTTTGAAGAGATTCGAGCCATTCCTTCACATTGCTCATGGTTGTCAACCATACAGTGCGGTTGATGGTTATGGAAATACCAGGTATGAAAACTACTTTTTCCTTTCCCTTCTGATATCGC-TTTACTAACACATTCTGTAGTGGTGGTCTCCAAGATACTGGCAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAGGGTCAAACCTATGTCAGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCTCCCCCATTCTCCCCCACCCATTTCACACCTTCTAACCCTTTTCAGATTTCCCCAAGGATCAACCAGCGGCTGGAAACGTCGTTGGAGGCCATCGTCACGACTGGGAGCACATCGTCGTCTGGGTCAACAACCCTTCCGTCGCCAACCCCACCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGACAGGGTGATAGATTGAAGGTCGAATACTATGTCTCTTTCCCAACCAACCACGAGTTGCAGTTCACCAACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGCTGTTAGCAAG Botrytis_tulipae_BT9830 GAGAACACCATCCAAGCTCGTGCCGTCGTTGCTCATGACTCCATCAACCCATGGCCAGAAAACGTCCCTGGTAACGCCATAGGTAACACTTTGAGGAAATTCGAGCCGTTCATTCACATTGCTCATGGTTGTCAACCATACAGTGCAGTTGATGGTTTTGGTAACACCAGGTATGAAAATTACTTTTTCCTCTCCCTTCTAATGTCAC-TTTACTAATACACCCTGCAGTGGTGGACTCCAAGATACTGGAAATGTCTCAGCCGGCTGCCGTGATCAGAGCAAAGGTCAAACCTATGTCCGAGGTGGCTGGTCTGGAGGTCGCTATGGTATCATGTACGCCTGGTGTAAGTATCCCATCTATTCT-CTCCACTC-TTTCATACCTTCTAACCCTCTTCAGATTGGCCCAAGGATCAACCAACAGCTGGAAACGTCATTGGAGGCCATCGTCACGACTGGGAGTACGTCGTCGCCTGGGTCAACAACCCTGCCGTCCCTGACCCCGTCTTGATCGGTGCCGCCGCATCTGGTCACGGAAGTGTGAAGAAGACGACCAATCCCCAACGCCAGGGTGATAGATTGAAGGTCGAATACTTTGTCCAGTTTCCAACCAACCACGAGTTGCAGTTCACCGACACATTGGGCAGAGATTTGCCAATGATGTGGTACGACTTCTTGCCAGGTGTTAGCAAG ; END; [ The following blocks are output data for analysis step 21043 ] BEGIN TREES; TITLE Botrytis_euroamericana_NEP1; LINK TAXA = TaxaForAnalysisStep21043; TREE Imported_tree_1 = [&R] ((((((((Botrytis_byssoidea_MUCL94:0.00554419,Botrytis_narcissicola_MUCL2120:0.01700545)0.0890:0.0,Botrytis_gladiolorum_9701:0.02000717)0.5930:0.00401192,(Botrytis_globosa_MUCL21514:0.00290613,Botrytis_sphaerosperma_MUCL21481:0.0074972)1.0000:0.0350367)0.6220:0.00337177,((Botrytis_polyblastis_CBS287.38:0.02818906,Botrytis_tulipae_BT9830:0.02938175)0.9970:0.02306093,(Botrytis_galanthina_MUCL3204:0.04511052,(Botrytis_croci_MUCL436:0.0,Botrytis_hyacinthi_0001:0.0)0.9990:0.01604076)0.6140:0.01488235)0.2150:0.00400573)0.4410:0.01190573,((Botrytis_ficariarum_CBS176.63:0.00789213,Botrytis_ranunculi_CBS178.63:0.00471457)0.4920:0.00700813,(Botrytis_deweyae_CBS134649:0.01392442,(Botrytis_elliptica_BE9714:0.00323022,Botrytis_squamosa_MUCL1107:0.00417013)0.6870:0.00135259)0.9640:0.00723798)0.9870:0.02245351)0.9950:0.02846901,((((Botrytis_euroamericana_AK10:0.0,Botrytis_euroamericana_HA06:0.0)0.5820:0.0,Botrytis_euroamericana_B83:0.00147068)1.0000:0.05084905,(Botrytis_aclada_BA5:0.0,Botrytis_aclada_MUCL8415:0.0)1.0000:0.04021547)0.8550:0.01452251,(Botrytis_convoluta_MUCL11595:0.03138386,(Botrytis_fragariae_U14P1:0.02130046,(Botrytis_paeoniae_GBG22:0.0,(Botrytis_paeoniae_0003:0.0,Botrytis_paeoniae_HA11:0.00146375)0.2330:0.0)1.0000:0.04165363)0.9370:0.01398864)0.3770:0.00983297)0.1300:0.0)0.5420:0.01653244,(Botrytis_calthae_MUCL2830:0.01314306,(Botrytis_cinerea_HA08:0.00730442,(Botrytis_fabae_MUCL98:0.01959474,((Botrytis_cinerea_BcB:0.00146369,Botrytis_eucalypti_CERC7170:0.0)0.5480:0.0,(Botrytis_cinerea_MS05:0.0,Botrytis_pelargonii_MUCL1152:0.00293307)0.6920:0.00146373)0.7160:0.0)0.4080:0.00309862)0.9290:0.01586475)0.9970:0.03127381)1.0000:0.01205101,(Botrytis_porri_MUCL3234:0.06333632,Botrytis_prunorum_Bpru1.9:0.04118363)1.0000:0.06962047); [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr105260] END;