#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on March 03, 2024; 7:04 GMT TreeBASE (cc) 1994-2008 Study reference: Achimon F., Johnson L., Cocucci A., Sersic A., & Baranzelli M.C. 2018. Species tree phylogeny, character evolution and biogeography of the Patagonian genus Anarthrophyllum Benth. (Fabaceae). Organisms Diversity & Evolution, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S22152] [ The following blocks are input data for analysis step 22322 ] BEGIN TAXA; TITLE TaxaForAnalysisStep22322; DIMENSIONS NTAX=40; TAXLABELS Anarthrophyllum_andicolum Anarthrophyllum_burkartii_A Anarthrophyllum_burkartii_B Anarthrophyllum_capitatum_A Anarthrophyllum_capitatum_B Anarthrophyllum_cumingii_A Anarthrophyllum_cumingii_B Anarthrophyllum_desideratum_A Anarthrophyllum_desideratum_B Anarthrophyllum_desideratum_C Anarthrophyllum_elegans_A Anarthrophyllum_elegans_B Anarthrophyllum_elegans_C Anarthrophyllum_elegans_D Anarthrophyllum_gayanum_A Anarthrophyllum_gayanum_B Anarthrophyllum_macrophyllum_A Anarthrophyllum_macrophyllum_B Anarthrophyllum_ornithopodum Anarthrophyllum_patagonicum_A Anarthrophyllum_patagonicum_B Anarthrophyllum_patagonicum_C Anarthrophyllum_pedicellatum_A Anarthrophyllum_pedicellatum_B Anarthrophyllum_rigidum Anarthrophyllum_rigidum_B Anarthrophyllum_rigidum_C Anarthrophyllum_strigulipetalum_A Anarthrophyllum_strigulipetalum_B Anarthrophyllum_subandinum_A Anarthrophyllum_subandinum_B Argyrolobium Aspalathus_longifolia Baptisia_bracteata Dichilus_strictus Genista_tinctoria Laburnum_anagyroides Sellocharis_paradoxa Spartium_junceum Thermopsis_barbata ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M44414] TITLE Anarthrophyllum_ITS; LINK TAXA = TaxaForAnalysisStep22322; DIMENSIONS NCHAR=646; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Anarthrophyllum_andicolum GTCTTAGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGATTTTAACTCAGCCACCTTCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTACCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGCGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCC- Anarthrophyllum_burkartii_A ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGGCCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCC- Anarthrophyllum_burkartii_B ??????????????????????????????????????????????????????????????????????????????????????????CAGCCACCTTCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGGCCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCC- Anarthrophyllum_capitatum_A GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_capitatum_B GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGA??????????- Anarthrophyllum_cumingii_A GTCTTAGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGATTTTAACTCAGCCACCTTCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTACCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_cumingii_B GTCTTAGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGATTTTAACTCAGCCACCTTCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTACCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCT??????????????????????????????- Anarthrophyllum_desideratum_A GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_desideratum_B GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_desideratum_C GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_elegans_A GTCTTAGGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_elegans_B GTCTTAAGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAAGGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_elegans_C GTCTTAGGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_elegans_D GTCTTAGGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCT??????????????????????????????- Anarthrophyllum_gayanum_A GTCTTAGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGATTTTAACTCAGCCACCTTCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCACGCAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCCAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCCCA- Anarthrophyllum_gayanum_B GTCTTGAGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGATTTTAACTCAGCCACCTTCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATCCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCACGCAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCCCA- Anarthrophyllum_macrophyllum_A GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_macrophyllum_B GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_ornithopodum GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_patagonicum_A GTCTTAGGCAGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_patagonicum_B GTCTTAGGCAGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_patagonicum_C GTCTTAGGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_pedicellatum_A GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_pedicellatum_B GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_rigidum GTCTTGGGCGGCCAACAGACCCCCAATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_rigidum_B GTCTTGGGCGGCCAACAGACCCCAAATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_rigidum_C GTCTTGGGCGGCCAACAGACCCCCAATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCT??????????????????????????????- Anarthrophyllum_strigulipetalum_A GTCTTAGGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_strigulipetalum_B GTCTTAGGCGGCCAACAGACCCCATATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATTGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGATGCCTAGCACGTGGCCAAGGCACAAAGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGTGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCTACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCACAGGGATGGGGCGCCCTCCCAACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGTCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_subandinum_A GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Anarthrophyllum_subandinum_B GTCTTGGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGTTGCTCGCGGGAAGCCAGCATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGGACCGTCTCCGGAGCCGACGGGGGCGCAACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCGCGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTAGAGTAGTCAAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Argyrolobium GTCTTAGGCGGCCAACAGAACCCCCATGGGTCACAGAGTTCGCAAAGCTGGTGGGGGTGACTACGCACGATCGATCTCGAGCTTTAATCTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGCGAGACGTTGCTTGCGGGAAGCCAACATTCGCCCCGCTCGGTGCCTAGCACATGGCCAAGGCAGAAGGGGCAACGATGTGCAACACCCAGGCAGGCATGCCCTCAACCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCAAGATATCCGTTGCCGAGAGTCTTTCGTATAACACGTGTCGAAACACCGCCCGCACGGGCACCGTCTCCGGAGCCGACGGGGGCGACACTAAACGATTTCAATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACTGCGCAGGGATGCGGCACCCTCCCGACACGAGGGGGACCGAGGTGCCAAACACCTCTAGCCACCCCTTGAGTAGTCAAACAAATTCACGGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Aspalathus_longifolia GTCTTGGGCGACCAGCGGAACGCTCATGGGCCATAGAGTTCGCAAAGCCGGTGGGGGTGACTACGCACGATCGGTCTCGAGCTTTTTACTCAACCACCATCCATCACGGCGCCCTCCACCACGGACTCAGTTTTACAACCAACCGTGAGGCGATGCTCACGGGAAGCCAGCACTCGCCCCGCTCGGTGCCTAGCGCGAGGCCAGGGCACTAGGGGCAACGATGGGCGACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCAGATAGCGCGTGTCGCAGCACCGCCCGCACAAGCACCGTCTCCGGAGCCGACGGGGGCGCCACTAAACGATTTCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTCGGCCAGGAGGAGACCACACAAGGTGGGGGCAGCCTCCCGACACGAGGGGGACCGAGGAGCCAAACACCTCTGGCCACCCCTTGAGTGGTCAAACAAATTCACGGGGTCACACTGTTTTGTGAGGCTTCGA????????????????- Baptisia_bracteata GTCATGGGCATCCAACAGGACGCTCATGGGTCACAGAGTACCCAAATCCGATAGGGGTGACTGCGCACGATCGATCTCGAGCTTTTTACTCAACCACCATGCATCGCGGCACCCTCCACCACGGACTCAATTTTACAACCAACCGTGAGACATAGCTCGCGGGAAGCCAACATTCGCCCCGCTCGAAGCCTGGCACAAGGCCGAGGCATTTGGGGCAACGATGTGCGACACCCAGGCAGGCGTGCCCTCGGCCTGATGGCTTCGGGCGCAACTTGCGTTCAACGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTGGGATAATGCGTGTCACTGCGCCACCCGCGGCGGCACCGTCTCCGGTGCCAACGGGGACGCCACCAGACAATATTGATTTCCTTGGCGCGTTCGGCGCCGGGGGTTTTGTTATAAGGCCAGGAGGAGACCGCGCAAGGAACGGGCTCGCCTCTGACACAATGGGGACCGAGGTGCCGAACACCTCTAGCCACCCCTTTAGTAGTCAAACAAATTCGCGGGGTCGCACTGCGTCGTTAGGCTTCGA????????????????- Dichilus_strictus GTCTTGGGCGACAAACAGAACGCCCATGGGTCACAGAGTTCGCAAGGCCGGTGGGGGTGACTACGCACGACCGGTCTCGAGCTTTTTACTCAACCACCATCCATCACGGCGCCCTCCACCACGGACTCAGTTTTACAACCAACCGTGAGACGTTGCCCGCGGGAAGCCAACATTCGCCCCGCTCAAGGCCTAGCGCGAGGCCAAGGCACTAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCGGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGCACCGTCTCTGGAGCCGGCGGGGGCGCCACTAAACGATTTTGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTCGGCCAGGAGGAGATCGCACAGGGACGGGCCGCCCTCCCGACACGAGGGGGGCCGAGGTGCCGAACACCTCTAGCCACCCCTTGAGTATTCAAACAAATTCGCGGGGTCGCACTGTTTTGTTAGGCTTCGA????????????????- Genista_tinctoria GTCATAGGTGGCCAACAGACCACCCATGGGTCACAGAGTTCGCAAAGCTAGTGGGGGTGACTACGCACGATCGGTCTCGAGCTTTAAACTCATCCACCATCCATCACGGTGCCCTCCACCGCGGACTCAGTTTTACAGCCAACCGTGAGACGTTGCTCACGGGAAGCCAACATTCGCCCCGCTCAGTGCCTAGCACAAGGCCAAGGCGCAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????- Laburnum_anagyroides GTCTTAGGCGGCCAACAGACCCCCCATGGGTCACAGAGTTCGCAAATCTGGTGGGGGTGACTACGCACGATCGGTCTCGAGCTTTAAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCGGACTCAGTTTTACAACCAACCGTGAGACGCTGCTCGCGGGAAGCCAACATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACTAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACGCGTGTCGCAACGCCGCCCGCACGGGCACCGTCTCCGGAGCCGACGGGGGCGCCACTAAACGATTTCATTTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCAGGAGGAGACCACGCAGGGATGGGGCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCTAGCCACCCATTGAGTAGTCAAACAAATTCACGGGGTCGCACTGCTTTGTGAGGCTTCGA????????????????- Sellocharis_paradoxa GTCTTAGGCGGCCAACAGACCCCCTATGGGTCACAGAGTTCCCAAAGCTGGTGGGGGTGACCACGCACGATCGGTCTCGAGCTTTTTACTCAGCCACCATCCATCACGGCACCCTCCACCGCGGACTCACTTTTACAACCAACCGTGAGACGTTGCTCACGGGAAGCCAACATTCGCCCCGCTCGGTGCCTAGCACGTGGCCAAGGCACAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCAGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCAGATAACGCGCGTCGCAGCGCCGCCCGCACGGCGACCGTCTCCGGAGCCGACGGCGGCGCTACTAAACGATATCGATTTCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTTTTGGGCCAGGAGGAGACCGCACAGGGATGGGCCGCCCTCCCGACACGAGGGGGACCGAGGTGCCGAACACCTCCAGCCACCCCTTGAGTAGTCTAACAAATTCGCCGGGTCGCACTGCTTTGTGAGGCTTCGACAATGATCCTTCCGCA- Spartium_junceum GTCTTAAGGGGCCAACAGACCCCCCATGGGTCACAGAGTTCACAAAGCTGGTGGGGGTGAGTACGCACGATCGGTCTCGAGCTTTAAACTCAGCCACCATCCATCACGGCGCCCTCCACCGCAGACTCAAATTTACAACCAACCGTGAGACACTGCTCACGGGAAGCCAACATACGCCCAAATCAATGCATAGCACGTGGCTAAGGCATAAGGGGCAACGATGTGCAACACCCAGGCAGGCGTGCCCTCGGCCTAAAGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTTTCGGATAACACGTGTCGCAACACCACCCGCACAGGCACCGTCTCCGGAGCTGACGAGGGTGCCACTAGACGATTTCAATATCCTTGGCGCGTTCGGCGCCGGGGCTTTTGTTATTGGGCCTGGAGGAGACCACACAAGGATGTGCTACCCTCCCGACACGAGGGGGACCGAGGTGCCGAAAACCTCTAGTCACCCCTTAAGTAGTCAAACAAATTCACGAGGTCGCACTGCTTTTTAAGGCTTCGA????????????????- Thermopsis_barbata GTCATGGGCGACCAACAAGACGCCCATGGGTCACAAAGTTCCCAAATCCGGCACGAGTGACTGCGCACGATCGATCTCGAGCTTTTTACTCAACCACCATCCATCGCGGCGCCCTCCACCACGGACTCAATTTTTCAACCAACCGTGAGACCTTGCTCGCGGGAAGCCAACATTCGCCCCACTCAAAGCCTAGCACAAGGCTGAGGCATTGGGGGCAACGA????????????????????????????????????????????????????????????????????????????????????????????????????TATCGCATTTCGCTACGTTCTTCATCGATGCAAGAGCCGAGATATCCGTTGCCGAGAGTCTCTGGGAT?ATGTGTGTCACAACGCCGCCCGCACCGACACCGTCTCCGATGCCAACGGGGGCGCCACTAGACAATCTTGATTTCCTTGGCGCATTCGGCGCCGGGG?TTTTGTTGTTAGGCCAGGAGGAGACCCCACAAGGTAGGGGCAGGCCTCCGGCACAAGGGGGACCGAGGTGCCAAGCACCTCTAGCCACCCCTTGAGTAGTCAAACAAATTCGCGGGGTCGCACTGTTTTGTTAGGCTTCGA????????????????- ; END; [ The following blocks are output data for analysis step 22322 ] BEGIN TREES; TITLE Anarthrophyllum_ITS; LINK TAXA = TaxaForAnalysisStep22322; TREE TREE1 = [&R] (Thermopsis_barbata:0.0239607071843895,(Baptisia_bracteata:0.047921414368779,((Aspalathus_longifolia:0.046991649805556014,Dichilus_strictus:0.046991649805556014):0.0071283784921315,(Genista_tinctoria:0.03703935099601792,(Spartium_junceum:0.03464110096836051,((Argyrolobium:0.024856892431811023,Laburnum_anagyroides:0.024856892431811023):0.004329314213126486,(Sellocharis_paradoxa:0.01778917181310001,(((Anarthrophyllum_rigidum_B:0.0011481880605926156,(Anarthrophyllum_rigidum:4.0717409581373515E-4,Anarthrophyllum_rigidum_C:4.0717409581371433E-4):7.410139647789013E-4):0.0027940319787689016,((Anarthrophyllum_capitatum_B:3.6269567036264355E-4,Anarthrophyllum_pedicellatum_A:3.6269567036265743E-4):0.0025734679793285933,((Anarthrophyllum_capitatum_A:3.351687574230794E-4,Anarthrophyllum_subandinum_B:3.3516875742310714E-4):0.0019062204444526276,((Anarthrophyllum_subandinum_A:7.649773529598419E-4,(Anarthrophyllum_macrophyllum_A:3.7234009040004734E-4,Anarthrophyllum_pedicellatum_B:3.7234009040006816E-4):3.9263726255976683E-4):7.034563347346409E-4,((Anarthrophyllum_desideratum_B:3.7838301053246676E-4,Anarthrophyllum_desideratum_C:3.783830105324737E-4):8.768262136442592E-4,(Anarthrophyllum_ornithopodum:7.880988503527198E-4,(Anarthrophyllum_desideratum_A:3.639172650159034E-4,Anarthrophyllum_macrophyllum_B:3.639172650159034E-4):4.2418158533684414E-4):4.6711037382399234E-4):2.13224463517743E-4):7.729555141812658E-4):6.947744478155021E-4):0.0010060563896702873):0.010134179290650816,(((Anarthrophyllum_gayanum_A:0.002736406413536431,Anarthrophyllum_gayanum_B:0.002736406413536431):0.00407072436956589,((Anarthrophyllum_burkartii_A:6.357362696766747E-4,Anarthrophyllum_burkartii_B:6.357362696766747E-4):0.004244888587539353,(Anarthrophyllum_andicolum:0.0023883786692673187,(Anarthrophyllum_cumingii_A:7.075313490637197E-4,Anarthrophyllum_cumingii_B:7.075313490637197E-4):0.001680847320203599):0.002492246187948653):0.0019265059258863626):0.005107616609629488,(Anarthrophyllum_elegans_B:0.0035517581240728097,((Anarthrophyllum_patagonicum_A:3.5440555669553897E-4,Anarthrophyllum_patagonicum_B:3.5440555669553897E-4):0.002270778263198367,((Anarthrophyllum_elegans_A:8.714618824350734E-4,(Anarthrophyllum_elegans_C:4.3784223483572804E-4,Anarthrophyllum_strigulipetalum_A:4.3784223483571416E-4):4.336196475993592E-4):0.0010264463199762125,(Anarthrophyllum_patagonicum_C:8.883689739345724E-4,(Anarthrophyllum_elegans_D:4.0179000877609006E-4,Anarthrophyllum_strigulipetalum_B:4.0179000877610394E-4):4.8657896515845456E-4):0.0010095392284766996):7.272756174826062E-4):9.26574304178987E-4):0.008362989268658999):0.0021616519372805038):0.0037127724830879894):0.011397034831837512):0.005454894323423002):0.0023982500276574087):0.017080677301669595):0.05973774890638679):0.0239607071843895); [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr109565] END;