#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on September 24, 2020; 11:50 GMT TreeBASE (cc) 1994-2008 Study reference: Boatwright J., Savolainen V., Wyk B., Schutte-vlok A., Forest F., & Bank M. 2007. Systematic position of the anomolous genus Cadia and the phylogeny of the tribe Podalyrieae (Fabaceae). Systematic Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1933] [ The following blocks are input data for analysis step 3958 ] BEGIN TAXA; TITLE TaxaForAnalysisStep3958; DIMENSIONS NTAX=198; TAXLABELS Acosmium_panamense Adenocarpus_viscosus Aenictophyton_reconditum Amphithalea_alba Amphithalea_axillaris Amphithalea_biovulata Amphithalea_ciliaris Amphithalea_cuneifolia Amphithalea_dahlgrenii Amphithalea_ericifolia Amphithalea_flava Amphithalea_fourcadei Amphithalea_imbricata Amphithalea_intermedia Amphithalea_michrantha Amphithalea_monticola Amphithalea_muirii Amphithalea_muraltioides Amphithalea_obtusiloba Amphithalea_oppositifolia Amphithalea_pageae Amphithalea_parvifolia Amphithalea_phylicoides Amphithalea_rostrata Amphithalea_speciosa Amphithalea_spinosa Amphithalea_stokoei Amphithalea_tomentosa Amphithalea_tortilis Amphithalea_villosa Amphithalea_violacea Amphithalea_virgata Amphithalea_vlokii Amphithalea_williamsonii Anagyris_foetida Anarthrophyllum_cumingii Aotus_carinata Aotus_cordifolia Argyrocytisus_battandieri Argyrolobium_harmsianum Argyrolobium_lunare Aspalathus_cordata Aspalathus_corrudifolia Baphia_madagascariensis Baptisia_australis Baptisia_tinctoria Bolusanthus_speciosus Bossiaea_lenticularis Bossiaea_lonophylla Brongniartia_alamosana Cadia_commersoniana Cadia_pedicellata Cadia_pubescens Cadia_purpurea Calicotome_villosa Calpurnia_aurea Calpurnia_glabrata Calpurnia_intrusa Calpurnia_sericea Calpurnia_sericea_x_woodii Calpurnia_woodii Chorizema_aciculare Chorizema_varium Crotalaria_capensis Crotalaria_pallida Cyclolobium_nutans Cyclopia_alopecuroides Cyclopia_alpina Cyclopia_aurescens Cyclopia_bolusii Cyclopia_burtonii Cyclopia_falcata Cyclopia_galioides Cyclopia_genistoides Cyclopia_glabra Cyclopia_intermedia Cyclopia_longifolia Cyclopia_maculata Cyclopia_meyeriana Cyclopia_plicata Cyclopia_pubescens Cyclopia_sessiliflora Cyclopia_subternata Cytisophyllum_sessilifolium Daviesia_mimosoides Dichilus_strictus Diplotropis_martiussii Ecinospartum_boissieri Erinacea_anthyllis Genista_teretifolia Genista_tournefortii Goodia_latifolia Goodia_medicaginea Heperolaburnum_platycarpum Hovea_elliptica Hypocalyptus_colutioides Hypocalyptus_oxalidifolius Hypocalyptus_sophoroides Isotropis_foliosa Isotropis_forrestii Jacksonia_alata Jacksonia_macrocalyx Laburnum_anagyroides Lebeckia_sessilifolia Lebeckia_wrightii Leptosema_daviesioides Liparia_angustifolia Liparia_bonaespei Liparia_boucheri Liparia_calycina Liparia_capitata Liparia_confusa Liparia_congesta Liparia_genistoides Liparia_hirsuta Liparia_latifolia Liparia_myrtifolia Liparia_parva Liparia_racemosa Liparia_rafnioides Liparia_splendens_comantha Liparia_splendens_splendens Liparia_striata Liparia_umbellifera Liparia_vestita Lotononis_alpina Lotononis_laxa Lupinus_arcticus Lupinus_polyphyllus Maackia_amurensis Melolobium_adenodes Melolobium_candicans Mirbelia_longifolia Mirbelia_specosa Muelleranthus_trifoliolatus Nemcia_plicata Oxylobium_cordifolium Pearsonia_grandifolia Pearsonia_sessilifolia Petteria_ramentacea Pickeringia_montana Piptanthus_tomentosus Podalyria_argentea Podalyria_biflora Podalyria_burchelli Podalyria_buxifolia Podalyria_calyptrata Podalyria_canescens Podalyria_cordata Podalyria_cuneifolia Podalyria_hirsuta Podalyria_intermedia Podalyria_lanceolata Podalyria_leipoldtii Podalyria_microphylla Podalyria_myrtillifolia Podalyria_oleaefolia Podalyria_orbicularis Podalyria_pearsonii Podalyria_rotundifolia Podalyria_sericea Podalyria_speciosa Podalyria_variabilis Podolobium_aciculiferum Poecilanthe_falcata Polhillia_pallens Pultenaea_pedunculata Pultenaea_stipularis Rafnia_alata Rafnia_vlokii Retama_monosperma Retama_sphaerocarpa Sophora_tetraphylla Sophora_toromiro Spartium_junceum Sphaerolobium_minus Sphaerolobium_nudiflorum Stauracanthus_genistoides_genistoides Stirtonanthus_chrysanthus Stirtonanthus_insignis Stirtonanthus_taylorianus Styphnolobium_japonicum Templetonia_retusa Thermopsis_divaricarpa Thermopsis_montana Ulex_densus Ulex_parviflorus Virgilia_divaricata Virgilia_oroboides_ferruginea Virgilia_oroboides_oroboides Xiphotheca_canescens Xiphotheca_cordifolia Xiphotheca_elliptica Xiphotheca_guthriei Xiphotheca_lanceolata Xiphotheca_phylicoides Xiphotheca_reflexa Xiphotheca_tecta ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2948] TITLE 'HighLevel_ITS'; LINK TAXA = TaxaForAnalysisStep3958; DIMENSIONS NCHAR=788; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acosmium_panamense ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCT-------AGAATGACTCTCGGCAACGGATATCTCGGCTCT??-??TCGATGAAGAA-CGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---GATGCCCG-CGCCCCGC-CTG---AGGGGGGCGACGG---GC--GGGGCTGGCGCTGGCCTCCCGCGA-GGAAC---GTCTCGCGGCTGGCTGAAAAATCGAGTC-CGTGGTGG--GGGC--GCGCCGCGAA-GGAT-GGTGGTTGAG-TGAAAG------GCTCGAGACCAGTCGC-GCGCG-CGAGCC--CACCGGCCCTGGG-ACT-CCGTGACCCATCGGGCGCCCGCGTCGG-----TCGTCC-ACGA-CGGGA-CCTCAGGTCA Adenocarpus_viscosus ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----GGAGGTGT--TCGG-CACCTC-GG-----CCCCC----CTCGTGTCGGGAGG-----CCCCCC---GCCCCGCGTGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TTGTTC-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG--CC-GTG-CGGGCG-GCG--TTGCGACACGCTT------ATCC--------GAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---TGTGCCTT-GGCCACGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAGC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GTGTG-TCACCCC-CACCAGCTTTGCG-GCT-CTGTGACCCATGGG----GCCTGTTGG-----CCGCCT-AAGA-CTGGA??????????? Aenictophyton_reconditum ???????????????????????????????????????????????????GACTT-GTG-AATT{AT}GTTTTATCT--ACTAA-GGGTTGG-TA----TGTGGTG--TTTAA-CGCCTC-TA-----CCTCC----CTTGTGTTGGGAGG--TGGTTGCC-------TAGCGTGA----TCTCCTCCT-AGCAAAA----C---AAAACCCCGGCG--CTGAATGCGTC---AAGGAACTC--CAAT-TTGTCT-AGTGCGCT-CCTGCAGACCC-AGAAATGGTG-CTC-TTG-CGGGA-TGCC--TTGCGACACATGAAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC----ATTCCAA-TGCCT-------------TGGGTATT{AG}A---GC--GGGGTGAATGCTGGCTTCCCGTGA-GCA--TTTGTCTCGTGGTTAGTTGAAAA-TTTAGTC-CATGGTGG--AGGA---TACCATGAT-ATAT-GGTGGTTGAG-TGAC--------CCTCGAGACCAATCGT-GGTTA-TCTCTCT---GTTTGTTTGGA--CT-CTAT-ACCCATGTG---TGTCTTCTAG-----ATACCC-ATAA-CGAGA-CCTCAGGTCA Amphithalea_alba TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CC---AAGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAACGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCTC-CACCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTC?????? Amphithalea_axillaris TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGAG-ACT-CTGTGACCCATGCG---CGTCCGTTGG-----GTGCTC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_biovulata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_ciliaris TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGC--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTAT-AGTGCGCCACCCGTCGGCCC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_cuneifolia ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCTCCT-?GGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAAAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GATGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGGCCGATCGT-GCGTG-TCACCCCCCACCAGGTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_dahlgrenii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-AAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_ericifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGATGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCCC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_flava TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CC---AAGACGTGC--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTAT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_fourcadei ??????????????????CATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AGGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGGACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGTGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCCCCATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCT??????? Amphithalea_imbricata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACCTA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GATGAGTT-CGTGGTGTGGAGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGGCCGATCGT-GCGTG-TCACCCCCCACCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGG?? Amphithalea_intermedia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAC-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCCTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_michrantha TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCG-GGGGCGG-CC---AATAGGTGT--TCTT-CACCTC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GAT-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTAGT-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-TACCGGCTTTGGG-ACT-CTGTGACCCGTGGG---CGTCCGTTGG-----GCACCC-ATGA-CGGG???????????? Amphithalea_monticola TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCAT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAAAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGTTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_muirii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGATC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_muraltioides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGTTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_obtusiloba TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGCG-GTG---TGCGACACGCGT-------TCC--------AAAA??????????????????????????????????????????????????????????????????????????????????????TGA?CCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGTTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_oppositifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCCC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACGCGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-ATCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_pageae TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCCC-AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT--GTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_parvifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGTTGTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_phylicoides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGTCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC?????????????????????? Amphithalea_rostrata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCC-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG-GTTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Amphithalea_speciosa TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGA???TCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_spinosa {GT}GAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCCACCCCTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-CACCTTGT-GCT-------AGGCACTGA---GC??GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGTTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTC{AT}GGT?? Amphithalea_stokoei TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---CGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCTGTC-------TCCTCCC-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCCC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_tomentosa TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CC---AAGAGGTGT--CCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GCGGGGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGA-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_tortilis TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGTTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_villosa TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGTTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGTC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_violacea TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGTA---GTATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--GATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_virgata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTAA-GGGGCGG-CT---AAGAGGTGT--CCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGC-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCAGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_vlokii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GGTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-CCACCCC-CACCGGCTTTCGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Amphithalea_williamsonii ???????????????????????TCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCG-GGGGCGG-CC---AATAGGTGT--TCTT-CACCTC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGA{AT}AT{CT}--GAAA-TCGTTT-AGTGCGCCCCCCGTCGGCTC-GGAGACGGTG-CTC-GT?-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTAGT-GCTGCT----AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-TACCGGCTTTGGG-ACT-CTGTGACCCGTGGG---CGTCCGTTGG-----GCACCC-AAGA-C??????????????? Anagyris_foetida ???????????????????????TCG-AAGCC-T-AAC-AAAGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGAGG-CC----AGAGGTGC--TTGG-CACCTC-GG-----TCCCC---TCTTGTGTC-GGAGG-----TGCCCC---TCCTTGTGTGGG---TCTCCTCCT-GGCCTAA-CAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--AAGA-TTGTCT-AGTCCGTC-CCCGTTGGCACCGGAGACGGTG-TCG-GTG-CGGGCG-GCG--TTGTGACACACAT------ATCC--------CAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAA-CGCAAGTTGCGCCCGAC-GCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATTCCTC-AGCCTCGT-GCT-------AGGCTTTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAG---GTCTCACGGTTGGTTGAAAAATTGAGTC-CCTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAGAA-------GCTCGAGACCGATCGT-GCGCG-TCACTCG-TGCCGAATTTGGG-ACC-TTGTGACCCATGGG--CGTCTTGTTGG-----TCGCCC?????????????????????? Anarthrophyllum_cumingii ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCGGCG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTCGTGTTGGGAGG-----CGCCCC---ACCCTGTGCGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTC-CCC-GTG-CGGGCG-GCG--TTGCGACACGCGT------ATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCGTTGCCCC---TGTGCCTT-GGCCACGT-GGT-------AGGCACCGA---GC--GGGGCGGATGTTGGCTTCCCGCGA-GCAAC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAA-GGTGGCTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTGGTCACCCC-CACCAGCTTTGCG-ACT-CTGTGACCCATGGG---GGTCTGTTGG-----CCGCCT-AAGA-CGGGAACCTCAGG??? Aotus_carinata ??????????????????????????????????????????????ATG-CGACCC-GCG-AATTTGTTTC-TCT--ACCGA-GGGCGGG-TC-CCCGGGG-CG--CCGGA-CGCCTC-GGTCGGGCCTCC----CTCGTGCCGGGAGG-----TGCTC----GCCCCGTGCGGG---CGCCATCCC-AGCACAT-CAAC----AACCCCCGGCG--CGGAATGCGTC---AAGGAACTC--GAAT-TTGTTA-AGCGCGCT-CCCGCGGACCC-GGAGACGGTG-ATC-CTG-CGGGG--GCG--TCGCGGCGCATGAAA----A{AC}AT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACATCGTTGCCCC---AACGCCAA-TGCCATCCCCAA-------GGGCATCGG---CC--GGGGCGGAAGTTGGCTTCCCGTGA-GCTCC---GCCTCGCGGTTAGTTGAAAA-TCGAGAC-CGTGGCGG--AGGG---CACCACGAT-TAATTGGTGGATGAG-TGCG--------TCTCGAGACCAGTCGT-GCGTG-CCCCTCC---ACCGGCGACGG-GCT-CCGTGACCCACGCG---TGTCCTCGCG-----ACACTC-TTAA-CGAGA-CCTCAGGTCA Aotus_cordifolia ??????????????????????????????????????????????GTG-CGACCC-GTG-AATTTGTTTC-TCT--ACCGAGGGGCAGGGCC--CCGGGG-TG--CTTGA-CGCCTC-GGG----CCTCC----CTCGTGCCGGGAGG-----TGCTC----GCCTCGTGCGGG---TGCCATCCC-AGCTTA---AAC---ACAACCCCGGCG--CGGAATGCGTC---AAGGAACTC--GAAT-TTGTTA-AGTGCGCT-CCCGTGGACCC-GGAGACGGTG-CTC-TGG-CGGGG--GCG--TCGCGGCGCATGAAA----ACAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AACCCCAA-TGCCGTCT-CAA-------GGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCATC---GCCTCGCGGTTAGTCGAAAA-TCGAGTC-CGTGGCGG--AGGG---CACCACGAT-TACTTGGTGGATGAG-TTCA--------TCTCGAGACCAGTCGT-GCGTG-CCTCTCT---TTCGTGAGCGG-GCT-CCGTGACCCATGCG---TGTCCTTGCG-----ACACTC-TTAA-CGAGA-CCTCAGGTCA Argyrocytisus_battandieri ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTT?-ACT--ACTC?-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGCCCC---ACCCTGCGTGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAGT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGC?CCGGAGACGGTG-ACC-GTG-CGGGTG-GCG--TTGCGACACGCGT------ATCC--------GAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---CGTGCCTT-GGCCACGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAGC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAG?TTTGCG-ACT-CTGTGACCCATGGG----GTCTGTTGG-----CCGCCT-AAGA-CGGGA??????????? Argyrolobium_harmsianum ????????????????????????CG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTT-ACT--ACTCA-AGGGTGG-CT----TGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGCCCC---ACACTGCGCGG----TCTCCTCCT-GGCCCAAATAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGTG-GCG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TGTGCCTT-GGCCACGT-GCT-------AGGCATCGA---TC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAC---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA--------------------------------------------------G-CCT-CTGTGACCCATGGG---GGTCTGTTGG-----CCGCCT?????????????????????? Argyrolobium_lunare ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TTGG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----TGCCGC---ACCCTGCGCAG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTTCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGCG-GTG--TTTCGACACGTGT------ATAC--------GAAAGACTCTCGGCAACGGATATCTTGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGTTGAGGGCATGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TCTGCCTT-GGCCATGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCAA-GCAAC---GTCTCGCGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAGATAAA--------GCTCGAGATCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT-CTGTGACCCATGGG---GGTCTGTTGG-----CCGCCT?????????????????????? Aspalathus_cordata ???????????????????????TCG-AAGCC-T--AC--AAACA-GTG-T-ACCC-GTG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CC----AGAGGTGT--TCTG-CTCCTC-GG-----CCCCC----CTCGTGTCGGGAGG-----CTGCCCCC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAC-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--CTGCGACACGCGC------ATCT--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCCT-GGCCTTGC-GCT-------AGGCACCGA---GC--GGGGCGAGTGCTGGCTTCCCGTGA-GCAAC---GCCTCGCGGTTGGTTGAAAT-ATGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTACGGCCCATGAG---CGTCTTTTGG-----TCGCCC?????????????????????? Aspalathus_corrudifolia ???????????????????????????????????????????????????GACCC-GTG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CC----AGAGGTGT--TCGG-CTCCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CTGCCCCC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--CTGCGACACGCGC------ATCT--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTA-GCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCCT-GGCCTCGC-GCT-------AGGCACCGA---GC--GGGGCGAGTGCTGGCTTCCCGTGA-GCAAC---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCCTTGCG-ACT-CTATGGCCCATGAG---CGTCTGTTGG-----TCGCCC?????????????????????? Baphia_madagascariensis ?????????????????ACATTGTCG-ATGCC-T-CAC--AACCT-GAG-CAACCC-GTG-AACCTGTTT--ACCTATTTTC-GGGGCGA-CTT----GGGGTGC--TTGGCCACCTC-AA-----CCGCC-----TCGTGTTAAAGGGGGG--CGCGC------CTTGTGCCG----TCTCCTCTTGAACCGAA-CA-C----AAACCCCGGCG--CTGGATGCGCC---AAGGAATTC--TAAC-GCGTTT-GCTGCGCC-CCCGTCGGCCC-GGATGCGGTG-CCC-GCG-CGGGTG-GTG--TCGTGACAAATGAAA----ATTC-------AGAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTCCCCC---AATGCCAA-TGCCGCGA-------------GCACTGA---GC--GGGGTGAGAGTTGGCTTCCCGTGG-GC-AC--GGTCCCGCGGTTAGTCGAAAA-TCGAGTC-CGTGGCGG--AGCAC-ATGCCACGAC-ATAT-GGTGGTTGAGATAAGA-------GCTCGACGCCGGTCGT-GCGCT-TGTCTCC--GTCGAACCTGGG-CTC-TGCGACCCCGTGCA-----TCTTCTGA-----TCGCCC-ATAA-CGAGA-CTC-AG-TCA Baptisia_australis ???????????????????????TCG-AAGCC-T-AAC-GACGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTAA-GGGGTGG-CT----AGTGGTGT--TCGG-CACCTC-GG-----TCCCC---CATTGTGTC-AGAGG-----AGCCCG---TCCTTGCGCGG----TCTCCTCCT-GGCCTTA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--AATA-TTGTCT-AGTGCGTC-CCCGTTGGCACCGGAGACGGTG-CCG-CTG-CGGGTG-GCG--CTGTGACACGCAT------ATCC--------CAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAA-CGCAAGTTGCGCCCGAA-GCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC--AAATGCCTC-GGCCTTGT-GCC-------AGGCTTCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCTAT---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGTGGTGG--AGGG---TGCCGCGAT-GCAT-GGTGGTTGAG-TAAAA-------GCTCGAGATCGATCGT-GCGCG-TCACCCC-TATCGGATTTGGG-CCT-CTGTGACCCATGAG---CGCCTGTTGG-----ATGCCC?????????????????????? Baptisia_tinctoria ???????????????????????TCA-AAGCC-T-AAC--AAGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTAA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TACCC---CATTGTGTC-AGATG-----AGCCCG---TCCTTGTGCGG----TCTCCTCCT-GGCCTTA-TAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--AAGA-TTGTCT-AGTGCGTC-CCCGTTGGC-CCGGAGACGGTG-CCG-CTG-CGGGTG-GCG--TTGTGACACGCAT------CTCC--------CAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---AATGCCTC-AGCCTTGT-GCT-------AGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCTAT---GTCTCGCGGTTGGTTGAAAA-TTGAGTC-CGTGGTGG--AGGG---TGCCGCGAT-GGCT-GGTGGTTGAG-TAAAA-------GCTCGAGATCGATCGT-GCGCG-TCACCCC-TATCGGATTTGGG-ACT-CTGTGACCCATGAG----CTCTGTTGG-----TCGCCC?????????????????????? Bolusanthus_speciosus ???????????????????????CCG-AAGCC-T-CACG--AGCA-GCG-CGACCC-GCG-AACTTGTTTG-ACC--ACTCA--GGGTGG-CC----GGAGGTGT--TCGG-CACCCC-GG-----CCCCC----CTCGCGTCGGGAGG-----CGGCCA--TCCCTCGTGCGGCC--TCCCCTCCC-GGCCGAA-TAAC---AAAACCCCGGCG--CTGGATGCGCC---AAGGAAATC--GAAA-TCGTTG-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGCG-GCG--TCGCGACACACGCGT----ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCGGAGGGCACGCCTGCCTGGGTGTCGCGCATCGTTGCCCC---CACGCCTT-GGCCTCGT-GCT----AGG---CATCGA---GC--GGGGCGAACGCTGGCTTCCCGCGA-GCAAC---GTCTCACGGTTGGTTGGAAA-TCGAGTC-CGTGGCGG--GGGA---TGCCGCGAT-GGAT-GGTGGTTGAG-TCCGA-------GCTCGAGACCGATCGT-GCGGG-T????????????????????????????????????????????????????????????????????????????????????? Bossiaea_lenticularis ???????????????????ATTGTCG-ATGCC-T-CAC--AAGCA-ATG-TGCCAT-GTG-AATATGTTTT-TCT--AGCAAAGGGTTGG-C----TTGTGGTG--TTTAG-CACCTC-AAA----CCCAA----AACATGTTGGGAGG-----TGCTC----ACCTAGTGTGG----TCTCCTCCT-AGCAAAA-CA-C----AAACCCCGGCG--CTGAATGCGTC---AAGGAACTT--AAGT-TTGTTT-AGTGCACT-CCCGTACACCC-GAACATGGTG-CTT-ATG-CGGG---TTGTGTTGTGACAT--GAAA----TTAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCTTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTACCCT---TACTCCAA-TGCCTTTT-GTT-------AGGTATGGA---GC--AGGGTAAAGGTTGGCTTCCCATGA-GCA--TTTGTCTCGTGGTTAGTTAAAAT-TTGAGTT-TATGATGG--AGGG---TATCACGAT-AAAT-GGTGGTTGAG-T-ATG-------CCTCGAGACCAATCGT-GTACA-TCTCTTA---ATTTCTTTATGTACT-CTATCACCCATGTG---TGTCTGATAG-----ATACCC-ATAA-CGAGA-CCTCAGGTCA Bossiaea_lonophylla ???????????????????ATTGTCG-ATGCC-T-CAC--AAGCA-ATG-TGCAAT-GCG-GATATGTTTT-TCT--AGGCGAGGGTTGG-T----CTGTGGTG--TTTAA-CACCCC-AACAA--CCAA-----AACATGTTGGGAGC-----TGCTC----ACCTAGTGTGG----TCTCCTCCT-AGCAAAA-CA-C----AAACCCCGGCG--CTGAATGCGTC---AAGGAACTT--AAAT-TTGTTT-AGCGCGCT-CCCGTACACCC-GAACACGGTG-CTT-GTG-CGGG---GTGTGTTGTGGCAT--GAAA----CTAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCTTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTTCCCT---ATTTTCAA-CGCCTTTT-GTT-------AGGTATGGA---GG--AGGGTAAATGTTGGCTTCCCATGA-GCG--TCTGTCTCGTGGTTAGTTGAAAA-TTGAGTT-TAAGATGG--AGGG---TATCACGAT-AAAT-GGTGGTTGAG-TTATG-------CCTCGAGACCAATCGT-GTACA-TCTCTTA---ATTTCTTTG--TACT-CTGTCCCCCATGCG---TGTCCAATGG-----ATACCC-ATAA-CGAGA-CCTCAGGTCA Brongniartia_alamosana ??????????????????CATTGTCG-ATGCC-T-CAC--AAGCA-GTG-CGACTC-GCG-AATTTGTTTG-ACT--TGATT-GGGGCGGGC-----AGGGGTGC--TCGA-CACCTC-GG-----CCCCC----CCGGTGCTGGGAGG-----CGCTT----GCCTAGTGCGG----TCTCCTCCC-GGCAAA--CAAC----CAACCCCGGCG--CAGAATGCGCC---AAGGAACTA--GAAA-TCGTTC-GGTGCGCC-CCTGTCGGCCC-GGAGACGGTG-CCC-GCG-CGGGG--GCG--TTGCGACA--CGAA-----TTCC-------AAAACGACTCTCGGCAACGGATATCTCGGCTCTCG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---ATTCCCGG-CGCCTGC------------GGGCACCGG---GC--GTGGCGAATGCTGGCTTCCCGGGA-GCACC---GTCTCGCGGTTGGCTGAAAG-TCGAGCC-CGTGGTGG--AGTG---CACCGCGAC-GGAT-GGTGGTTGAG-GGA---------ACTCGAGACCAGTCGC-GCGCG-TCGGCC---TCCCCGTCTCGG-ACT-CTGTGACCCACGAG---CGG-ATTCGG-----TCGCCC-ACAA-CGGGA-CCTCAGGTCA Cadia_commersoniana TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GAGCA-GAG-CGACCC-GCG-AATACGTTTG-ACT--ACTCG-GGGGCGG-CT----AGAGGCGTG-TTCCACACCTCTGG-----TCCCC----CTTGTGTCGGGAGG-----CGCCGCTGCA-CGGCCGTG-------TCGTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGGGACGGTG-CTC-GTG-CGGGTG-GTG--TCGCGACACTAGT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cadia_pedicellata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GAGCA-GAG-CGACCC-GCG-AATACGTTTG-ACT--ACTCG-GGGGCGG-CT----AGAGGCGT---TCCACACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGGCGCTCCA-CGGCCGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGGGACGGTG-CTC-GTG-CGGGTG-GTG--TCGCGACGCTAGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGCAGCAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cadia_pubescens TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GAGCA-GAG-CGACCC-GCG-AATAAGTTTG-ACT--ACTCG-GGGGCGG-CT----AGAGGCGTG-TTCCACACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGCCGCTGCA-CGGCCGTG-------TCGTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGGGACGGTG-CTC-GTG-CGGGTG-GTG--TCGCGACACTAGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGCAGCAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cadia_purpurea TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GAGCA-GAG-CGACCC-GCG-AATACGTTTG-ACT--ACTCG-GGGGCGG-CT----AGAGGCGTG-TTCCACACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGCCGCTGCG-CGGCCGTG-------TCGTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGGGACGGTG-CTC-GTG-CGGGTG-GTG--TCGCGACACTAGTA--TCTATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGCAGCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Calicotome_villosa ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCTGTG-AATTTGTTTG-ACT--ACTCG-GGGGTGG-CT----AGAGGTGT--TCGG-CACCAC-GG-----TCCCC----CTCTTGCCAGGAGG-----TGT-AC---ACCCTGTGTGA----TCCCCTCCT-GGCCAAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAAT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCTC-GGAGACGGTG-CCA-GTA-CGGGCG-GCG--TTGCGACACGCGT------ATCT--------GAA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCGTTGCCCC---AATGCCTT-GGCCACGT-GCT-------AGACATTGA---GT--GGGGCGAATGTTGGCTTCCCGCGA-GTATC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-TGTGGTGG--AGGT---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TGACCCC-CACCAGATTTGTG-ACT-CTGTGACCCATGGG----GTCTGTTGG-----CCGCCT-AAGA-CGGGA??????????? Calpurnia_aurea TGAACATGCGG-AAGGATCATTGTCG-AAGCC-T-CACAAGATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----ATAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCCGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CGGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTA-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTTTAGGCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGCTGGCTTCCCGCGA-GCAAA---GCCTCGCGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC--ACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGCCCGTTGG-----TCGCCC-ATGAGCGGGA-CCTCATGT?? Calpurnia_glabrata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CACACGATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----ATAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CGGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTA-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTTTAGGCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGCTGGCTTCCCGCGA-GCAAA---GCCTCGCGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCGCCCC--ACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGCCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Calpurnia_intrusa TGAACCTGCGG-AAGGATCATTGTCG-AAGCCCT-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----ATAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGCCGCTCCT-GAGCGGAC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGC----GTATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-GGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Calpurnia_sericea TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GTTCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----ATAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTA-CGGGTG-GTG---TGCGACATGCGT-------TCC--------AAAAGA??????????????????????????????????ATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATTGTTGCCCCC--AATGCCTTTAGCCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGCTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGCG---CGCCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Calpurnia_sericea_x_woodii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CACAAGATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----ATAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CGGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTA-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTTTAGGCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGCTGGCTTCCCGCGA-GCAAA---GCCTCGCGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC--ACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGCCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Calpurnia_woodii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CACAAGATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----ATAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CGGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTA-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Chorizema_aciculare ??????????????????????GTCG-ATGCC-T-CAC--AA-CA-GTG-CGACCC-GTG-AATTTGTTTA-TTT--ACCGA-GGGCAGG-CT---CGGGGGTG--CTCGA-CACCTC-AGA----CCTCC----CTTGTGCCGGGATG-----TGCTC----TCCCTGCGCGGGCG-ATGCCTTCC-AGCTTAA-CA-C----AATCCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAA-TTGTTA-AGTGCGAC-CCTGTGGACCC-GGAGACGGTG-CTC-TTG-CGGGG--GCG--TCGCGATGCATGAAA----ATAT-------GAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA-TGCCATTT-CAC-------GGGCATTGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCGTC---GCCTCGCGGTTGGTTGAAAA-TCGAGTC-CGTGGTGG--AGGA---CACCACGAT-TAATTGGTGGATGAG-TGTA--------TCTCGAGACCAATCGT-GCGTG-CCTCTCT---TCCGTGATCGG-GCT-CCGAGACCCATGCG---TGCCGTCACG-----GCACCC-TTAA-CGAGA-CCTCAGGTCA Chorizema_varium ???????????????????ATTGTCG-ATGCC-T-CAC--AAGAT-GTG-CGACCC-GCG-AATCTGTTTA-TCT--ACCGG-GGGCGGG-CT---CCGGGGTG--CTCGA-CACCTC-GGA----CCTCC----CCCGTGCCCGGACG-----TGCTC----TCCCCGTGCGGGCG-ATGCCTTCCGGGCTTAA-CA-C----AATCCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAA-TTGTTA-AGTGCTCC-CCCGCGGACCC-GGAGACGGTG-CTC-CTG-CGGGG--GCG--TCGCGACGCATGGAAA---ATAC-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AACGCTCG-TGCCATTT-CAC-------TGGCATCGA---GT--CGGGTGAAAGTTGGCTTCCCGTGA-GCGTC---GCCTCGCGGTTGGTTGAAAA-TCGAGTC-CGTGGTGG--AGGG---CACCGCGAT-TAATTGGTGGATGAG-TGTA--------TCCCGAGACCGATCGT-GCGTG-CCTCTCT---TCCGTGACCGG-GCT-TCATGAATGACCCA---CGCGTGTCGTCAC-GGCACCC-CTAA-CGAGA-CCTCTTGTCA Crotalaria_capensis ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTG-ACG--AGTGA-GGGATGG-CT----AGAGGTGC--TCGG-CATCTC-GG-----TCACC----CTCGTGTCGG-AGG-----TGTCGG---ACCTTGTGCG-----TCTCCTCCC-GGTTGAA-TAAC---AAAACCCCGGCG--CCGAACGTGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCACC-CCCGGCGGCTC-GGAGACGGTG-CTC-GTG-CGGGCG-GTG--ATGCGACACGCGT------ATCA--------GAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---AGTGCCTT-GGCCTCGT-GCT-------AGGCACCGA---GC--TGGGCGAATGTTGGCTTCCCGCGA-GCAAC---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGGCGCGAT-GGAT-GGTGGTTGAG-TTAAA-------GCTCGAGACCCATCGT-GCGTG-TCACCCC-CACCGGCATTGCG-ACT-CTGTGATCCATGAG---C-TCTCTTGG-----TCGCCC?????????????????????? Crotalaria_pallida ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTG-ACG--TGTGA-GGGATGG-CT----TGAGGTGT--TCTC-GTCCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----TGCCAC---ACCTTGTGTGG----TATCCTCTC-GTTCGAA-TAAC---AAAAACCCGGCG--CTCAATGCGCC---AAGGAGAAC--GAAA-TCGTTT-AGTGCACC-CCCGCGGGCTC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--AAGCGACACGTGT------ATTC--------GAAGGACTCTCGGCAACGGATATCTTGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCATGCCTGCCTGGGTGTCGCCCATCGTTGCCAC---AGTTCCTT-GGCCTCAT-GCT-------AGGCACCGA---GC--TGGGCGAATGCTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAAA-TTGAGTC-CATGGTGG--GTGG---CACCGTGGC-GGAT-GGTGGTTGAG-TAA-GTT--AAAGCTTGAGACCCATCGT-GGTTG-TCACCCA-CACCGGCATTTGG-ACTTCTATCATCCATGAG---CGCCTATTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclolobium_nutans ??????????????????CATTGTCG-AAGCC-T-GCC--GAGCA-GCG-CGACAC-GCG-AACTCGTTTG-ACT---CTTG-GGGGTGG-CC----GGGGCTGCTCTCGG-CCCCCC-GG??????????????????TGCCTGGGGG-----GACCC----GCCTCGCGCGG----TCTCCGCCC-GGCAAA--CAAC----CAACCCCGGCG--CCAGACGCGCC---AAGGAACTA--GAAA-TCGTTC-GGCGCGCC-CCCCTCGGCCC-GGAGACGGTG-CCT-GCG-CGGGG--GCG--TCGCGACA--CGCG-----ATCC-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTCG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCGCACGTCGTTGCCCA---AAAGACGG-TGCCTCAT-CGC-------GGGCGCCGG---TC--GGGGCGAAGGTTGGCTTCCCGGGA-GCATC---GTCTCGCGGTTGGCTGAAAG-TCGAGCC-CGCGGCGG--AGAG---CGTCGCGAC-GGAT-GGTGGTTGAG-GAA---------TCCCGAGACCGGTCGTTGTGT---CGCCT---TCCCTGCTTCGG-ACT-CTGTGACCCAGGGG---CGGC-GTCGG-----TCGCCC-ACAA-CGGGA-CCTCAGGTCA Cyclopia_alopecuroides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-AAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTTA-GGGGTGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGTGG-----CGTCGCTCCT-CGGAGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCCCC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cyclopia_alpina TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACA--ACTCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCTT-{CG}GGCGGTC-------GCCACCT-GACAGAT-TA{AC}C---AAAACCCCG{CG}CG--CCG{AC}ACGCGCC---AAGGAAAT????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCTGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_aurescens TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GACTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_bolusii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTTA-GGGGTGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTCGTGTTGGGTGG-----CGTCCCTCCT-CGGAGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGCCGGCTC-GGAGACGGTG-CTT-GTG-CGGGTG-G???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GT--GGGGCGGATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGGC-GCGCCGCGGT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGC-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_burtonii TGAAC-TGCGG-AAGGACTATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACC--GTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TCATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CATCAGGT?? Cyclopia_falcata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-A{AC}T--ACTCA-GGGGCGG-CT------AGGTGTG{CT}TTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT-------TCC--------AAAA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cyclopia_galioides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGAGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGATG-----CGTCGCTCCA-CAGCGTTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CGGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT------TATGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGCGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATTGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGG?? Cyclopia_genistoides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGGG----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_glabra ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCTTGT-GCT------?AT?CACTGA---?T--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG--GCGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCTAGACCGATCGT-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCTGTTGG-----CTGCCC-ATGA-CGGGA-CCTC-GGT?? Cyclopia_intermedia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGCAGC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Cyclopia_longifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACT--ACCCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGTGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-TTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_maculata TGAAC-TGGGG-AATGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACA--ACTCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTCCCGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACGGATCGT-GTGTG-TCACCC--CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCTGTTGG-----CTGCCC-ATGA-CGGGA-C-TCAGGT?? Cyclopia_meyeriana TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CGC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT------AGGCGTGTTTT--CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACTT-GACCGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCT--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG--GCGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCTAGACCGATCGT-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCTGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAAGT?? Cyclopia_plicata ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_pubescens TGAAC-TGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCTTCGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cyclopia_sessiliflora ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TCC?GTGA?CCATCGAGTCTTTGA?-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--A{GT}TGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---C{CT}CCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGA{GT}ACTGATCGT-GTGTG-T{GT}ACCCC-CATC?GCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCA{GT}GT?? Cyclopia_subternata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-TAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT------AGGTGTGTTTTG-CACCTT-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------GCCACCT-GACAGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCCCCACCTGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTATGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AGTGCCTT-AGCCTTGT-GCT------TAGGCACTGA---GT--GGGGCGAATGTTGGCTTCCCGTGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTC-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CATCGGCTTTGGG-ACT-CTG--ACCCATGGG---CGTCCGTTGG-----CTGCCC-ATGA-CGGGA-CCTCAGGT?? Cytisophyllum_sessilifolium ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-AG-----TCCCC----CTCGTGTCGGGAGG-----CGCCCC---ACCCTGCGTGG----TCTCCTCCT-GGCCAAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAAT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG--CC-GTG-CGGGGT-GCG--TTGCGACACGCGT------ATCC--------GAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---AGCGCCTT-GGCCACGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAGC---GTCTCACGGTTGGTTGAAAA--TGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGATGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGATTTGCG-ACT-CTGTGACCCATGGG----GTCTGTTGG-----CCGCCT-AAGA-CGGGA??????????? Daviesia_mimosoides ??????????????????????????????????????????????GAG-TGACCA-GCG-AACTTGTTGT-TCT--ACTTA-TGGTTGG-AT---TGGGG-TG--TTCAA-CACCAC-AA-----CCTCC----CTTTTGCTAGGAGT-----TTTTC----TCCTGGCTG-------------------------AAC--ATAAACCTCGGCG--CTAACTGCGTC---AAGGAACT---TAATCTTGTCT-CGTGCGCC-CTTGTTGACCC-AAATATGGTG-TTC-T-G-CGGGTT-GTA--CTGTGGCATTTGCAA----ACAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCATTAGGTTGAGGGCACGCCTGCTTGGGTGTCACACAATGTTATCCC---AATGCCGA-TGCAGTAC-TCA-------AAGTACTTG-CTAC--GGGGTAATTGTTGGCTTCCCGTGA-GCATT---GTCTTGCGGTTAGTTAAAAG-TTGAGTC-CGTTATGG--AGAG---TACCGTAAT-AGAT-GGCGGTTGAT-TGAAA-------GATCGAGACCAATTGT-GTATC-TCCATTG-------TATTCGG-ATTCTTGTGACCCATGTG---TGTTGTCTAG-----ACACCC-ATAA-CGAGA-CCTCAAGTCA Dichilus_strictus ???????????????????????????????????????????CA-GTG-CGACCC-GCG-AATTTGTTTG-AAT--ACTCA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----CCCCC----CTCGTGTCGGGAGG-----CGGCCC---GCCCTGTGCGA----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--AAAA-TCGTTT-AGTGCGCC-CCCGCCGGCCC-AGAGACGGTG-CCC-GTG-CGGGCG-GCG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---AGTGCCTT-GGCCTCGC-GCT-------AGGCCTTGA---GC--GGGGCGAATGTTGGCTTCCCGCGG-GCAAC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGGTCGT-GCGTG-TCACCCC-CACCGGCCTTGCG-ACT-CTGTGACCCATGGG---CGTCTGTTTG-----TCGCCC?????????????????????? Diplotropis_martiussii ???????????????????????????????C-T-CAC--AAGCA-ACG-CGACTC-GTG-AATCTGTTTG-ACT--GCCTG-GGGGCGT-CA----GGGGGTGT--TCTG-CACCAT-GG---CCCCTCG----CTCGTGCTGGGAGG-----CACCC----GCCTCGCGCGG----ACTCCTCCT-GGCCGAG-CAACTTGAAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--GAAA-TCGTTT-AGCGCGCC-CACGTCGGCCC-GGAGACGGTG---------CGGGTG-GCG---CGTCGCGA----------ATCC-------AATATGACTCTCGGCAACGGATATCTCGGCTCTCG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATTGTTGCCCC---AATGCCGG-TGCCTCGC-GCT---GAGGGGGCATCGA---GC--GGGGCGAGCGTTGGCTTCCCGTGA-GCGTC---GTCTCGCGGTTGGTTGAAAAATCGAGCC-CGTGGTGC--GGAGCG-CACCGCGAT-AGAC-GGTGGTTGAG-CAAAAA------GCTCGAGACCAGTCGT-GCGTG-TCAGCCC--ACCGACCTCGGG-ACT-CTGTTACCCACGAG---CGCCGATTGG---TCGCGCCC?????????????????????? Ecinospartum_boissieri ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCGGTG-AATTTGTTTG-ACT--ACTGCAGGGGTGG-CT----ACAGAGGTGTTCGG-CACCTC-GG-----CCCCC----CTCGTGTCGGGAGG-----CGCCAC---ACGTTGTGTGG----TCTCTTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CGGAATGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CTCGTCGGCCC-GGAGACGGTG-CC---TG-CGGGCG-GCG--TATCGACACGCGT------ATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCGTTGCCCC---CGTGCCTC-GGCCACGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAC---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGCGGTGG--AGGG---CACCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-CCACCCC-CACCAGCTTTGGG-ACT-CTGTGACCCATGGG---GGTCTGTTGG-----CCGCCC-AAGA-CGGGAACCTCAGG??? Erinacea_anthyllis ???????????????????????TCG-AAGCC-T-CAC--AAGCA-ATG-CGACCCCGTG-AATTTGTTTA-ACT--ACTTA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTCATGTCGGGAGG-----TGCCTC---ACCCTACGTGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTCGCC--GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCT--------TAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---TGTGCCTT-TGCCACGC-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAGT---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT-CTGTGACCCAAGGG----GTCTGTTGG-----CCTCCT-AAGA-CGGGA??????????? Genista_teretifolia ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TTGG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGCCCC---ACCTTGCGTGG----TCTCCTCCT-GGCCTAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCTGTCGGCCC-GGAGACGGTG--CT--TG-CGGGTG-GCG--TTGCGACACGCTT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC-ATTGTGCCTT-GGCCATGT-GCT-------AGACACCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAGC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CACCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATTGT-GCGTG-TCCCACC-CACCAGCTTTGTG-ACT-CTGTGACCCATGGC---GGTCTGT???????????????????????????????????? Genista_tournefortii ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CAACCCAGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----ATAGATGT--TTGG--ACCTT-GG-----TCCCC----CTTGTGTCAGGAGT-----TGCCC----ACCTTGCGTGG----TCTCGTCCT-GGCCAAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTAT-AGTGCACC-CCCG-CGGCCC-GGAGACGGTG-CCC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCT--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGTCCC---TGTGACTT-GGCCACGT-GCT-------AGGCACCAA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAAC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CACCGTGAT-GGAT-GGTGGCTGAG-TTAAG-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGTG-ACT-CTGTGACCCATGGG---GGTCTGTT??????????????????????????????????? Goodia_latifolia ????????????AAGGATCATTGTCG-ATGCC-T-CAC--AAGCA-GAG-TGACCT-GTG-AATTTGTTAT-TTT--ACTG-GGTGTCGG-T----TTG-GGTG--TTCAA-CACACA-AG-----CCTCA----CTTACGTTGGGAGG---AGGTTCC----ACGTGTATTCGCGG-ACGCCTCCC-AGCTCTAACA-C----AAACCCCGGCG--CTGAATGCGTC---AAGGAACTC--AAAT-TTGTTT-AGTGCGTT-CCCGTATGCCC-GGAGACGGTG-CCT-ATG-CGGAA--GCG--TTGCGACACATGAAA----ATCT--------AAACAACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTACCCT---CTCCCCAA-CGCCTTT--ACT------TGGGCGTTGA---GT--CGGGTGAATGTTGGCTTCCCATGA-GCCG-TTTGTCTCGTGGTTAGTTAAAAT-CCGAGTC-CATGGTGG--AGGG---CGCCATGAT-AACT-GGTGGTTGAG-TAAA--------CCTCGAGACTACTCGT-GCGTG-TCCCTCT---ATCAATTTGGA-TTT--CCTTGCCCATGCG---TGTCTTACGG-----ACGCTC-ATAA-CGAGA-CCTCAGGTCA Goodia_medicaginea ???????????????????ATTGTCG-ATGCC-T-CAC--AAGCA-GAG-TGACCT-GTG-AATTCGTTAT-TCT--ACTA-GGTGTTGG-T----CTG-GGTG--TCTAA-CACACA-AG-----CCTCA----CTTACGTTGGGAGG---AGGTTCC----ATGTGTATTCGTGA-ACGCCTCCC-GGCTTTAACA-C----AAACCCCGGCG--CTGAATGCGTC---AAGGAACTC--AAAT-TTGTTT-AGTGCGTT-CCCGTATACCC-GGAGACGGTG-CTT-ATG-CGGAA--GCG--TTGCGACACATGAAA----ACTG--------AAACAACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTACCCT---CTCTCCAG-TGCCTTT--ACC------TGGGCATTGA---GT--CGGGTGAATGTTGGCTTCCCATGA-GCCG-TTTGTCTCGTGGTTAGTTAAAAT-CTGAGTC-CATGGTGG--AGGG---TGCCATGAT-AACT-GGTGGTTGAG-TAAA--------CCTCGAGACTACTCGT-GCGTG-TCCCTCT---ACTAATGTGGA-TTT--TGTTGCCCATGCG---TGTCTTGTTACAG--ACACTC-ATAA-CGAGA-CCTCAGGTCA Heperolaburnum_platycarpum ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--ACGG-CACCTC-GG-----TCCCC----CTCGTGCCGGGAGG-----CGCCCC---ACCCTGCGTGG----CCTCCTCCT-GGACCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAAT--GAAA-TCGTTT-AGTGCGCC-CCCGCCGGCCC-GGAGACGGTG-CCC-GTG-CGGGCG-GCG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---AGTGCCTT-GGCCACGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAGA---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGATTTGCG-ACT-CTGTGACCCATGGG---GGTCTGTT??????????????????????????????????? Hovea_elliptica ???????????????????ATTGTCG-AAGCC-T-CAC--AAGCA-GTG-CGACTC-GCG-AATTTGTTTG-ACT--TGATT-GGGGCGGGC-----AGGGGTGC--TCGA-CGCCTC-GGCCCCCCCTCC----CCGGT-CTGGGAGG-----AGCCC----GCCTAGTGCGG----TCTCCGGCC-GGCCGA--AAACAACCAAACCCCGGCG--CCAAATGCGCC---AAGGAACTA--GAAA-TTGTTC-GGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTC-GTG-CGGGG--GCG--TCGCGACA--CGCG-----AATTAAAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---ATTCCCGG-TGCCTCGT-CGC-------AGGCGCCGG---GC--GTGGCGAATGCTGGCTTCCCGGGA-GCACC---GTCTCGCGGTTGGCTGAAAG-TCGGGCC-CGTGGTGG--AGTG---CACCGCGAC-GGAT-GGTGGATGAG-GGAA--------ACTCGAGACCAGTCGC-GCGCG-T-GGCC---TCCCCTTTTCGGCACT-CTGTGACCCACGAG---CGGCATTCGG-----TCGCCC-ACAA-CGGGA-CCTCAGGTCA Hypocalyptus_colutioides ???????????????????????TCG-ATGCC-T-CAC--AAGCA-ATG-CAACCT-GTG-AATTTGTTTG-TCT--ATAT--GGAGTGG-AT-----GGGGTG--TTTCCACACACC-AA-----CTGCT----CTCAGGTTGGGAGG-----TGCCC----ATTATATGCGGC---GTTCTCTTT-AACCAAA-CA-C----AAACCCCGGCG--CTAAATGCGTC---AAGGAACTC--GAATTTTGTTC-ATTGCGCC-CCTACGGACCCCGGAAACGGTG-ATC-GTG-CGGGTG-CTG--TTGTAACACAGCA------AACT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACACATCGTTACCCC---TATCCCAA-TGCCTAGT-GTT-------TGGTATAGA---GC--GGGGTGAATGTTGGCTTCCCGTGC-GAATC---TTCTCACGGTTGGTTGAAAT-TTGAGTC-TATGGTAG--AGTG---TACCATGAT-AGAT-GGTGGTTGAG-TAAA--------TCTCGAGACCAATCGT-GCGTG-TCTCTCT--GCCGGGTAACGG-ACT-CTGTGACCCGTTTG---CGTCCTCTGA-----ACGCTC?????????????????????? Hypocalyptus_oxalidifolius ???????????????????????TCG-ATGCC-T-CAC--AAGCA-ATG-CAACCT-GTG-AATTTGTTTG-TCT-CATAT--GGAGTGG-AG-----GGGGTG--TTTC-ACACACC-AA-----CTGCT----CTCAGGTTGGGAGGG----TGCCC----ATTTTATGCGGT---GTTCTCTTT-AACCAAA-CA-C----AAACCCCGGCG--CTAAATGCGCC---AAGGAACTG--GAAT-TTGTTCATTTGGGCC-CCTACGGACCCCGGAAACGGTG-ATC-GTG-CGGGTG-CTG--TTGTAACACACTA------ATCT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACACATCGTTACCCC---TATCCCAA-TGCCTAGT-GTT-------TGGTATAGA---GC--TGGGTGAATGTTGGCTTCCCGTGC-GAGTC---TTCTCACGGTTGGTTGAAAT-TTGAGTC-TATGGTAG--AGTG---TACCATGAT-AGAT-GGTGGTTGAG-TAAA--------TCTCGAGACCAATCGT-GCGTG-TCTCTCT-CCCCGGGTAACAG-ACT-CTGTGACCCGTTTG---CGTCCTTTGA-----ACGCTC?????????????????????? Hypocalyptus_sophoroides ???????????????????????TCG-ATGCC-T-CAC--AAGCA-ATG-CAACCT-GTG-AATTTGTTTG-TCT--ATAT--GGAGTGG-AT-----GGGGTG--TTTCCACACACC-AA-----CTGCT----CTCAGGTTGGGAGG-----TGCCC----ATTATATGCGGC---GTTCTCTTT-AACCAAA-CA-C----AAACCCCGGCG--CTAAATGCGTC---AAGGAACTC--GAATTTTGTTC-ATTGCGCC-CCTACGGACCCCGGAAACGGTG-ATC-GTG-CGGGTG-CTG--TTGTAACACAGCA------AACT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACACATCGTTACCCC---TATCCCAA-TGCCTAGT-GTT-------TGGTATAGA---GC--GGGGTGAATGTTGGCTTCCCGTGC-GAATC---TTCTCACGGTTGGTTGAAAT-TTGAGTC-TATGGTAG--AGTG---TACCATGAT-AGAT-GGTGGTTGAG-TAAA--------TCTCGAGACCAATCGT-GCGTG-TCTCTCT--GCCGGGTAACGG-ACT-CTGTGACCCGTTTG---CGTCCTCTGA-----ACGCTC?????????????????????? Isotropis_foliosa ???????????????????????????????????????????????AT-TGACCC-GCG-AATATGTTTT-TCA--ACTA-GGGTTGGA-TC-----GGGGTG--TTTAA-CACCTC--GA----CCTCC----CTCGTGTTGGGAGG-----TGATC----ACCCTGCGTG-----GTCTCTCCT-GGCCAAA-CA-C---AAAACCCCGGCG--CTGAATGCGCC---AAGGAAATC--GAAT-TTGTTT-AGTGCGCT-CCCGTAGACCC-GGAGACGGTG-CTC-TTA-CGGGCG-GCG--TTGCGACGTATGCAT----ATAA-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA----CGCTT-CAC-----ACGAGTGTTGA---GC--GGGGCGGAAGTTGGCTTCCCGTGA-GCAT----GTCTCGTGGTTAGTTGAAAA-TTGAGTC-CATGGTGG--AGGG--AAACCGTGAT-TAAT-GGTGGTTGAG-TAAAA-------GCTCGAGGCCAATCGT-GCGCT-TCTCTTT---GTCGTAACTGG-ACT--CGTGACCCAAGTT---TGTCCGATGG-----ACAACC-ATAA-CGAGA-CCTCAGGTCA Isotropis_forrestii ??????????????????????????????????????????????GAT-TGACCC-GTG-AATATGTTTT-TCA--ACTA-GGGTTGG--CT---CGGGG-TG--TTTAA-CACCTC--GAGA--CCTCC----CTCGTGTTGGGAGG-----TGATC----ACCTTGCGTGG-----TCTCTCCT-GGCCAAA-CA-C---AAAACCCCGGCG--CTGAATGCGTC---AAGGAAATC--GAAT-TTGTTC-AGCGCGCT-CCCGTAGACCC-GGAGACGGTG-CTC-TTA-CGGGCG-GTG--TTGCGACATATGCAT----ATAC-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA-TGCTTCAC-AGA--------GGTGTTGA---GC--GGGGCGGAAGTTGGCTTCCCGTGA-GCATG----TCTCGTGGTTAGTTGAAAA-TTGAGTC-CATGGTGG--AGGG--AAACCGTGAT-TAAT-GGTGGTTGAG-TAAAA-------GCTCGAGGCCAATCGT-GCGCT-TCTCTTT---GTCGTAACTGG-ACT--CGTGACCCAAGTT---TGTCCGATGG-----ACAACC-ATAA-CGAGA-CCTCAGGTCA Jacksonia_alata ???????????????????ATTGTCG-ATGCC-T-CAC--AAGCA-GAT-TGACCC-GTG-AATTTGTTTA-TCTC-ACCG---GGCAGG-CT---CGGGGGTG--CTTTG-CACCTC-AGA----CCTCC----CAAGTGCCGGGAGG-----CGCTC----GCCCCGTGCGGGGGGTGCCATCCC-GGCCGAA-AAAC----AATCCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAC-TTGTTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-CTC-TTG-CGGGG--GCG--TTGCGACACATGAAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCACTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA-TGCCATTT-GAC-----ATGGGA--------TC--GGGGCGAATGCTGGCTTCCCGTGA-GCTCG---GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGCGG--AGCG---CACCACGAT-TTATTGGTGGATGAG-TGAA--------TCTCGAGACCAATCGT-GCCTG-CCTGCTC---GCCGTGACCGG-ACG-CA{GT}T{GT}ACCCATGTG---TGTCTTCACG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Jacksonia_macrocalyx ???????????????????ATTGTCG-ATGCC-T-CGC--AAGCA-GAC-CGACCC-GCG-AATTTGTTTA-TCT--ACCG---GGCGGG-CT---CGGGGGTG--CTCCG-CACCTC-AGA---CCCTCC----CAAGTGCCGGGGCC------GCTC----GCCGCGCGCGGG---TGCCGTCCC-GGACGAA-CA-C----AATCCCCGGCG--CGGAATGCGCC---AAGGAAATC--GAAC-TTGTTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-CTC-CTG-CGGGG--GCG--TCGCGATGCATGAAA----ATAC-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCACTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AACGCCAA-TGCCATTT-CGC-----ATGGGA-TCCG---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCTACG--GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGCGG--AGCG---CACCGCGAT-TTATTGGTGGATGAG-CGTC--------CCTCGAGACCAATCGT-GCGTG-CCGCCC----GCCGTGACCGG-ACC-CAGCGACCCACGCG---TGTCTTCGCG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Laburnum_anagyroides ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTG-ACT--ACTCA-TGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGCCCC---ACCCTGCGTGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAAT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGCG-GCG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---AGTGCCTT-GGCCACGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAGC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGATTTGCG-ACT-CTGTGACCCATGGG---GGTCTGTT??????????????????????????????????? Lebeckia_sessilifolia ???????????????????????TCG-AAGCC-T-CAC--AAACA-GTG-TGACCC-GTG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CC----AGAGGTGT--TTGG-CTCCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CTTCCCAC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCCT-GGCCTCGC-GCT-------GGGCACCGA---GA--GGGGCGAATGCTGGCTTCCCGTGA-GCAAC---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ATT-CTGTGGCCCATGAG---CGTCTGTTGG-----TCGCCC?????????????????????? Lebeckia_wrightii ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-TGACCC-GCG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CC----AGAGGTGT--TTGG-CTCCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CCCCCCC--ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GAG-CGGGCG-GTG--TTGCGACACGCGC------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCCT-GGCCTCGA-GCT-------AGGCACCGA---CC--GGGGCGAATGCTGGCTTCCCGTGA-GCAAT---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTATGGCCCATGAG---CGTCTGTTGG-----TCGCCC?????????????????????? Leptosema_daviesioides ??????????????????????????????????????????????GAT-TGACCC-GTG-AATTTGTTTC-TCT--TTCGG-GGGCAGG-CT---CGGGGGTG--CTCGA-CACCTC-GGA----CCTCC----CTCGTGTTGGAAGA-----CACTC----GCCCCGTGCGAG---TGCCATCCC-AGCTAAA-CA-C----AAACCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAT-TGGCTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-CTC-TTG-TGGGG--GCG--TCGCGATGCATGGAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCCA-TGCCATTT-CAC-----ATGGTCATGGA---GC--TGGGCGAATGTTGGCTTCCCGTGA-GCGCA---GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGTGG--AGCG---TACCACGAT-TAATTGGTGGATGAG-TGAA--------TCTCGAGACCAATCGT-GTGTG-CAAATCT---GTCGCGAACGG-ACC-CGGTGACCCACGCG---TGTCGTTATG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Liparia_angustifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TTCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCC-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--CTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GCGCGGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCATCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_bonaespei TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGGCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GAAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_boucheri TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CAGCGGTA-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_calycina TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGTGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCTGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_capitata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTG-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCTGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_confusa TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--{AT}TTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TC{GT}TTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGC{GT}ATACTTGGTGTGAATTGCA{GT}AATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTC{GT}CACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGC-AATGTTGGTTTCCCGCAA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTTTCGTGGGGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC?????????????????????? Liparia_congesta TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTG-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCTGTTGG-----TCGCCC-ATGA-CGGGA-CCTC?GGT?? Liparia_genistoides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_hirsuta TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--CTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGGCCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_latifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG---TGCGACACGCGT-------TCC--------AAAAGA??????????????????????????????????????????????????????????????????????????????ATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_myrtifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_parva TGAAC-TGCGG-AAGGAT-ATTGTCG-AAGCC-T-CAC--GACGA-GAG-CGACGA-GCG-AATATGTTTGGACT--ACTGA-GGGGCGG-CT---AAGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGTGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCATATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGATTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_racemosa ??????????????????CATTGTCG--AGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_rafnioides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCT??????? Liparia_splendens_comantha ????????????????????????????????????????????????????????????????????????????????????????????????????????T--TTTG-CACCAC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCG?CTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCG???????????????????????????????????????????????????????????????????????????????????????????????????????ATCCCGTGAACCATCGAGTCTTTGA?-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTTTCGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_splendens_splendens TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATTA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTTTCGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_striata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ATTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCCC-AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCATG-TCACCCC-CACCGGCTTTGGG-ACT-CTTTAACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Liparia_umbellifera TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGT{CG}-------TCTTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Liparia_vestita TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Lotononis_alpina ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CT----AGAGGTGC--TTGG-CTCCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CTCCCCCC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--TGAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--TTGCGACGCGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCTT-GGCCTCGT-GCT-------AGGCACCGA---AT--GGGGCGAATGCTGGCTTCC-GCGA-GCAAT---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AAGT---CGCCGTGAT-GGAT-GGTGGTTGAA-TAAAA--------CTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGATTTGCG-ACT-CTATGGCCCATGGG---CGTCTTTTGG-----TC-CCC?????????????????????? Lotononis_laxa ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-GGACCC-GTG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CT----AGAGGTGT--TTTG-CTCCTC-GG-----CCCCC----CTCGTGTCGGGAGG-----CTCCCCCC-AC-TC-AGGGG----TATCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCAAACGCGCC---AAGGAAATC--TAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--TTGCGACGCGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCTT-GGCCTCGC-GCT-------AGGCACCGA---GC--GGGGTGAATGCTGGCTTCCCGCGA-GCAAT---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CATGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTACGGCCCATGAG---CGTCTTTTTG-----TCGCCC?????????????????????? Lupinus_arcticus ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTT-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TTGG-CACCTC-GG-----TCCCC----CTCGTGTCAGGAGG-----CGCCAC---ATCCTGTGCGG----TCTCCTCCT-GGCCTAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTTCGCC-CCCGTCGGCACCGGAGACGGTG-CTC-GTG-CGGGCG-GCG--TTGCGACACGCTT------ATCC--------TAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TGTGCCTT-GGCCACGT-GCC-------AGGCACCAA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAT---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT-CTTTGACCCATGGG---GGTCTGTTGG-----CCTTCT?????????????????????? Lupinus_polyphyllus ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTT-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TTGG-CACCTC-GG-----TCCCC----CTCGTGTCAGGAGG-----CGCCAC---ATCCTGTGCGG----TCTCCTCCT-GGCCTAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--TAAA-TCGTTT-AGTTCGCC-CCCGTCGGCACCGGAGACGGTG-CTC-GTG-CGGGCG-GCG--TTGCGACACGCTT------ATCC--------TAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---CGTGCCTT-GGCCACGT-GCC-------AGGCACCAA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAT---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT-CTTTGACCCATGGG---GGTCTGTTGG-----CCTTCT?????????????????????? Maackia_amurensis ???????????????????????TCG-AAGCC-T-CACG-ATCCA-G-G-CGACCC-GCG-AATTTGTTTT-ACC--ACTC--GGGGCGG-CG----AGAGGCGT--TTCG-CGCCTC-GG-----TCCCC----CTAGTGTC-GGAGG-----CGCCCG---TTCTCGTGCGG----GCTCCTCTT-GGCCTAA-TAAC---AAAACCCCGGCG--TTGAATGCGCC---AAGGAAATC--GAGA-TCGTCT-AGTGCGCC-CCCGTCGGCCC-GGGGACGGTG-CTT-GTG-CGGGGG-ACG--TCGTGACA--CGCGT----ATCC---------AAA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CACCGTTGCCCC---AATGCCCG-AGCCTCGT-GTC-------GGGCACCGA---GC--AGGGCGAATGTTGGCTTCCCGGGA-GCAAG---GTCTCACGGTTGGTTGAAAA-TTGAGCC-TGTGGTGG--AGGA---CGCCGCGAT-GGAC-GGTGGTTGAT-TTAAA-------TCTCGAGACCG-TTGT-GCGCG-TCACCCC-TACCGGATTTGGG-ACT-CTGTGACCCATGTG----AGCGGCCGG-----TCGCC??????????????????????? Melolobium_adenodes ???????????????????????TCG-AAGCC-T-CAC--GAGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CGACCC---ACCCTGTGCGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAGA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGAAGGTG-GCC-GTG-CGGGCG-GCG--TTGCGACACGCTT------ATCC--------GGAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCT---AGTGCCTT-GGCCTCGC-GCT-------AGGCACCGA---GT--GTGGTGAATGTTGGCTTCCCGTGA-GCAAC---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGTGGTGG--AGGG---TGCCATGAT-AGAT-GGTGGCTGAG-TGAGTG--AAAAGCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTGTGACCCATGGG---CGTCTGTTGG-----TCGCCC?????????????????????? Melolobium_candicans ???????????????????????TCG-AAGCC-T-CAC--GAGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-AGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CAACCC---ACCCTGTGCGG----TCTTCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAGA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGATG-GCC-GTG-CGGGCG-GCG--TTGCGACACGCTT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCT---AGTGCCTT-GGCCTCGC-GCT-------AGGCACCGA---GC--GTGGTGAATGTTGGCTTCCCGTGA-GCAAC---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGTGGTGG--AGGG---TGCCATGAT-AGAT-GGTGGCTGAG-TGAAAA------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTGTGACCCATGGG---CGTCTGTTGG-----TCGCCC?????????????????????? Mirbelia_longifolia ??????????????????????????????????????????????GAT-TGACCC-GTG-AATTTGTTTC-TCT--TTCGG-GGGCAGG-CT---CGGGGGTG--CTCGA-CACCTC-GGA----CCTCC----CTCGTGTTGGAAGA-----CACTC----GCCCCGTGCGAG---TGCCATCCC-AGCTAAA-CA-C----AAACCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAT-TGGCTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-CTC-TTG-TGGGG--GCG--TCGCGATGCATGGAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCCA-TGCCATTT-CAC-----ATGGTCATGGA---GC--TGGGCGAATGTTGGCTTCCCGTGA-GCGCA---GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGTGG--AGCG---TACCACGAT-TAATTGGTGGATGAG-TGAA--------TCTCGAGACCAATCGT-GTGTG-CAAATCT---GTCGCGAACGG-ACC-CGGTGACCCACGCG---TGTCGTTATG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Mirbelia_specosa ???????????????????ATTGACG-ATGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTC-TCT--ACCGA-GGGCAGG-CT---CGGGGGTG--CTCGA-CACCTC-AAA----CCTCC----CTTGTGCCGGGAGG-----TGCTC----TCCCCGTGAGGG---TGCCATCCC-AGCTAAA-CA-C----AATCCCCGGCG--CGGAATGCGTC---AAGGAACTC--GAAT-TTGTTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-CTC-TTG-CGGGG--GCG--TCGCGATGCATGAAA----ATAC-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCGTTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA-TGCCATTT-CAC------AGG-CATTGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCGAT---GTCTCGCGGTTAGTTGAAAA-TTGAGCT-CGTGGTGG--AGGG---CACCGCGAT-TAATTGGTGGATGAG-TGTA--------TCTCGAGACCAATCGT-GCGTG-CCCCTCC---TCCGTGATCGG-GCT-TTGCGACCCATGCG---TGCCTTGAGG-----GCACCC-TTAA-CGAGA-CCTCAGGTCA Muelleranthus_trifoliolatus ????????????AAGGATCATTGTCG-ATGCC-T-TAA--AAGCA-GCT-TGACTT-GTG-AATTAGTTTA-TCC--ACTAA-GGGTTGTAT------G-GGTG--TTTAA-CACCTC-TA-----CCTCC----CTTGTGCTGGGAGG--TGCTTGCC-------TAGTGTGA----TCTCCTCCA-AGCAAAA----C---AAACCCCCGGCG--CTAAATGCGTC---AAGGAACTC--TAAC-TTGTCT-AGTGCGCT-CCGTTAGACCC-AGAAATGGTG-CTC-ACGATGGA--TGCG--TTGCGACACATGAAA----ATAT--------AAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCTGAA-GCCATTAGGCTGAAGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCT---ATATTCATATGCCTTT--ACT------TAGGTATTTT---GT--GGGGTGAATGTTGGCTTCCCATGA-GCA--TTTGTCTCGTGGTTAGTTGAAAA-TTGAGTC-CATGGTGG--AGGA---TACCATGAT-ATAT-GGTGGTTGAG-TTAA--------CCTCGAGGCCAATCAT-AGGTG-TCTCTTT---GTTTGTTTGGA--CT-CTAT-ACCCATGTG---TGTCCTATAG-----ATACTC-ATAA-CGAGA-CCTCAGGTCA Nemcia_plicata ???????????????????ATTGTCG-ATGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTC-TCT--ACCGG-GGGCAGG-AC---CGGGGGTG--CTCGG-CACCTC-AGG----CCTCC----CTTGTGCTGGGAGG-----CGCTC----GCCCCGTGCGGG---TGCGATCCC-AGCTAAA-CA-C----AATCCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAC-TTGTTA-AGCGCGCT-CCAGCGGACCC-GGAGACGGTG-CTC-TTG-CGGGG--GCG--ACGCGATGCATGGAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AACGCCAA-TGCCATTT-CAC-------GGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCACT---GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGTGG--AGCG---CGCCACGGT-TAATTGGTGGATGAG-TGTA--------CCTCGAGACCAACCGT-GCGCG-CGCCTCC-CTACCGTGATCGG-GCT-CCGTGACCCACGCG---TGTCGTCATG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Oxylobium_cordifolium ???????????????????ATTGTCG-ATGCC-T-CAC--AAGAA-GTG-CGACCC-GTG-AACTTGTTTC-TCT--ACCGA-GGGTAGG-CT---CGGGGGTG--CTCGA-CACCTC-AGA----CCTCT----CTTGTGCCGGGAGG-----TGCTC----TCCTCGTGAGGG---TGCCATCCC-AGCTAA--CA-C----AAACCCCGGCG--CGGAATGCGTC---AAGGAACTC--GAAT-TTGTTA-AGTGCGCT-CCCGTGGACCC-GGAGACGGTG-CTC-TTG-CGGGG--GTG--TTGCGACGCATGAAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA-TGCCATTC-CAC-------GGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCATT---GCCTCGCGGTTAGTTGAAAA-TTGAGTC-TGTGGTGG--AGAA---CACCACGAT-TAATTGGTGGATGAG-TGTA--------TCTCGAGACCAATCGT-GCGTG-CCTCTCT---TCCGTTATCGG-GCT-TCGAGACCCATGCG---TGTCGTCACG-----ACACTC-TTAA-CGAGA-CCTCAGGTCA Pearsonia_grandifolia ???????????????????????CCG-AAGCC-T-CAC--AAGCA-GTG-CGACCT-GTG-AATTTGTTTG-ACA---CTTA-GGGGTGG-CT--------------------ACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CTCCCCGC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--AAAA-TCGTTT-AGTGCACC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCT-GTG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGC-TGGGTGTCGCCCATCGTTGCCCC---AGTGCCTT-GGCCTCGT-GCC------AAGGCACCGA---GC--GGGGCGAATGCTGGCTTCCCGTGA-GCAAT---GCCTCACGGTTGGTTGAAAA-CTGAGTA-CGTGGTGG--TGGG---TGCCGTGAT-GGAT-GGTGGATGAG-TAAAA-------GCTCGAGACCTATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-GCT-CTATGGCCCATGAG---CGTGTGTTGG-----TCGCCC?????????????????????? Pearsonia_sessilifolia ???????????????????????CCG-AAGCC-T-CAC--AAGCA-GTG-CGACCT-GTG-AATTTGTTTG-ACA--ACTTA-GGGGTGG-CT--------------------ACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----CTCCCCGC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAGC--AAAA-TCGTTT-AGTGCACC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCTC-GGCCTCGT-GCT-------AGGCACCGA---TC--GGGGCGAATGCTGGCTTCCCGTGA-GCAAT---GCCTCACGGTTGGTTGAAAA-CTGAGTA-CGTGGTGG--AGGG---TGCCGTGAT-GGAT-GGTGGATGAG-TAAAA-------GCTCGAGACCTATCGT-GCGTG-TCACCCC-CACCGGCTTTGCG-ACT-CTATGGCCCATGAG---CGTGTGTTGG-----TCGCC??????????????????????? Petteria_ramentacea ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCCCGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGTGGTGT--TCGT-CACCTC-GG-----TCCCC----CTCATGTCGGGAGG-----CGCCCC---ACCCTGCGTGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTCT-AGTGCGCC-CTCGTCGGCCC-GGAGACGGTG-CCC-GTG-CTGGTG-GCG--TTGCGACACGTGT------ATCC--------GAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CATCGTTGCCCC---TGTGCCTT-GGCCATGT-GCT-------AGGCACCGA---GC--GGGGTGAATGTTGGCTTCCCGCGA-GCAAC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACTGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT-CTGTGACCCATGGG----GTCTGTTGG-----CCGCCT-AAGA-CGGGA??????????? Pickeringia_montana ???????????????????????TCG-ATGCC-T-TAC--AAGCA-ATA-CGACCC-GTG-AATTTGTTTG-ACT--ACTG--GGGC-GG-TT---CAGGG-TG--TTTAA-CACCTC-AA-----GCCCC----CT--TGTCGGGAGG-----CGACC----AACCCGTGTGG----TCTCCTTCT-GGCAAA--CAAC----AAACCCCGGCG--CCAAATGCGCC---AAGGAACTC--TAAA-TTGTTT-AGTGCGCT-CCCGTCGGCCC-GGAGACGGTG-CTC-GTG-CGGTGG-GCG--ATGCGACATATGTT-----ATCT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAG-TGCCTC-TTGT--------AGG--TCCTGA-GC--GGGGCGAATGTTGGCTTCCCGTGA-GCCTC---GTCTTGCGGTTGGTCGAAAA-TTGAGTC-CATGGTGG--AGAG---CACCATGAT-AGAT-GGTGGTTGAG-TTAAA-------TCTCGAGACCAATCGC-GCGTG-TCTCTTC---GCTGGGTTAGG-GCT-TTGTGACCCAGGAG---CATCATATGA-----TCGCCC-ATAA-CGGGA-C????????? Piptanthus_tomentosus ???????????????????????TCG-AA-CC-T-AAC-AAAGCA-GTG-CGACCC-GCG-AATATGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGC--TTGG-CACCTC-GG-----TCCCC---TCTTGTGTC-GGAGG-----TGCCCC---TCCTTGTGTGGG---TCTCCTCCT-GGCCTAA-CAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATA--AAGA-TTGTCT-AGTGCGCC-CTCGTTGGCACCGGAGACGGTG-TCG-GTG-CGGGCG-GCG--TTGTGACACACAT------ATCC--------TAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAA-CGCAAGTTGCGCCCGAC-GCCATCAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCTTTGA---GT--GGGGCGAATGTTGGCTTCCCGCGA-GCAAG---GTCTCACGGTTGGTTGAAAAATTGAGTCCCCTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGATCGATCGT-GCGCG-TCACTCG-TGCCGGATCTGGG-ACT-TTGTGACCCATGGG--CGTCTTGTTGG-----TCGCCC?????????????????????? Podalyria_argentea TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CCC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_biflora TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CCC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_burchelli TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_buxifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGCGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCAAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_calyptrata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAAACG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Podalyria_canescens TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAAACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Podalyria_cordata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAA???????????????????????????????????????????????????????????????????????????????????CCCGTGA?CCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_cuneifolia TGAACATGCGG-AAGGACTATTGTGCAAAGCC-T-CCC--GATCA-GAG-CGACCC-GCG-AATATGTTGG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCGCCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGG-A-CCTCAGGT?? Podalyria_hirsuta TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_intermedia TGAACGTGCGGCAAGGA-CATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCATTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CTTCAG-T?? Podalyria_lanceolata ????C-TGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_leipoldtii TGAACCTGCGG-ACGGATCATTGTCG-AAGCC-T-CCC--GATCA-GAG-AGGACC-GCGGAATATGTTTG-ACT--ACTGA-GGGGCGA-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTG-----TCCTCGCCC-ATGA-CGGGA-C-TCAG-T?? Podalyria_microphylla TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-C{CG}C--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_myrtillifolia TGAACATGCGGTAAGTATCATTGTCG-AAGCC-T-CCC--GATCA-GAG-CGACC--GCG-AATATGTTTGTTTG--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTT-AG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGG-A-CCTCAGGT?? Podalyria_oleaefolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAATA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_orbicularis TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGG-A-CCT??????? Podalyria_pearsonii ??????????????????????????????????????????????????????????????????????????????????????????-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCG???????????????????????????????????????????????????????????????????????????????????????????????????????AT?CCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGG-CACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_rotundifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT--------------------ACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACTG{AT}---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCCCGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_sericea TGAACGTGCGG-GATGATCATTGTCG-AAGCC-T-ACC--GATAG-GAG-CGACC--GCGGAATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----CCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGACTTGT-GCT-------AGGCATTGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCTATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTGTGG--TCCTCGCCC-ATGA-CGG-A-TCTCAGGT?? Podalyria_speciosa TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACTGA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAATA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podalyria_variabilis TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CCC--GATCA-GAG-CGACCC-GCG-AATATGTTTG-ACT--ACT?A-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGC-GGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCAT-AGACTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAAA--GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCTTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Podolobium_aciculiferum ???????????????????ATTGTCG-ATGCC-T-CAC--AAGCA-GAG-CGACCC-GCG-AATTTGTTTC-TCT--ACCAA-GGGCAGG-CC---CGGGGGTG--CTCGT-CGCCTC-CGG----CCTCC----CTTGTGCCGGGAGG-----TACTC----GCCCCGTGCGGG---TGCCATCCC-AGCTAAAACA-C----AATCCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAT-TTGTTA-AGTGCGCT-CCCGTGGACCC-GGAGACGGTG-ATC-TGG-CGGGG--GCG--TCGCGACGCATGAAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCA---AATGCCAA-TGCCTTTT-CAC-------GGGCATCTT---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCATC---GCCTCGCGGTTAGTTGAAAA-TTGAGTC-CGTGGTGG--AGCG---CGCCACGGT-TAATTGGTGGATGAG-TGTA--------TCTCGAGACCAATCGT-GCGCG-TGCCTCT-CTTCCGTGATCGG-GCT-CCGTGACCCACGCG---TGTCGTCATG-----GCACCC-TTAA-CGAGA-CCTCAGGTCA Poecilanthe_falcata ?????????????????TCATTGTCG-AAGCC-T-CGA--AAGCA-GCG-CGACAC-GTG-AATTTGTTTG-ACT--GCATG-TGGGTGG-CC----AGGGGTGC--TTGA-CGCCCC-GG------CCCC----TCGGTGCTGGGGGG-----GCCCT----GCCCTGCGCGG----TCTCCTCCC-GGCAAA--CAAC----CAACCCCGGCG--CTGTATGCGCC---AAGGAACTC--GAAA-TCGTTC-AGTACGCC-CCCTAAGGCCC-GGAGACGGTG-CTC-GCG-GGGCG--GCG--CCACGACG--CTTGG----ATCA--------TAACGACTCTCGGCAACGGATATCTCGGCTCTCG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---TACGCCGG-TG-----------------------------CA--GGGGCGAATGTTGGCTTCCTGTGA-GCACT---GTCTCGCGGTTGGCTGAAAG-TCGAACC-TGTGGTGG--AGTG---CACCGCGAC-GGAT-GGCGGTTGAA-GGA---------ACTCGAGACCAGTCGC-GCGTG-TCGCCC---TCCGTGCTTCGG-ACT-CTGTGACCCACGAG---CGAT-GCCAG-----TCGCCC-ACAA-CGGGA-CCTCAGGTCT Polhillia_pallens ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCTCGTG-AATTTGTTTG-ACT--ACTCA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TCCCC----CTTGTGTCGG-AGG-----ACCCCC---ACCGTGCGCGG----TCTCTTCCT-GGCCCAT-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGCG-GCG--TTGCGAAACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TGTGCCTT-GGCCATGT-GCT-------GGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAAC---GTGTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTTCG-ACT-CTTTGACCCATGGG---GGTCTGTTGG-----CCGCCT?????????????????????? Pultenaea_pedunculata ??????????????????????????????????????????????ATG-CGACCC-GTG-AATTTGTTTC-TCT--ACCGA-GGGCAGG-CT---CGGGGGTG--CTCGA-CACCTC-AGA----CCTCC----CTTGTGCCGGGAGG-----TGCTC----GCCCCGTGCGGG---TGCCATCCC-AGCTAAA-CA-C----AATCCCCGGCG--CGGAATGCGCC---AAGGAACTC--GAAT-TTGTTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-TTC-CTG-CGGGG--GCG--TCGCGACACATGAAA----ATAC-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCAAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAA-TGCCATTT-CAC-------AGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCATC---GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGTGG--AGCG---CACCGCGAT-TAATTGGTGGATGAG-TGATA-------CCTCGAGACCAATCGT-GCGTG-CTTCTCT---TCCGTGGTCGG-GCT-CCGTGACCCATGCG---TGTCGTCATG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Pultenaea_stipularis ????????????????????????????????????????????A-ATG-CGACCC-GCG-AACATGTTTC-TCT--ACCGA-GGGCAGG-CC---CCGGGGTGC-CTCGG-CACCTC-GGA----CCTCC----CTTGTGCCGGGAGG-----CGCTC----GCCCCGTGCGGG---CGTCATCCC-AGCCGAA-CA-C----AATCCCCGGCG--CGGAATGCGTC---AAGGAACTC--GAAT-TTGTTA-AGTGCGCT-CCCGCGGACCC-GGAGACGGTG-CTC-TCG-GGGGG--GCG--TCGCGATGCATGAAA----ATAT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCA---AACGCCAA-TGCCATTC-CAT-------GGGCATCC-G--GC--GGGGCGAATGCTGGCTTCCCGTGA-GCACC---GCCTCGCGGTTAGTTGAAAA-TCGAGTC-CGTGGTGG--AGAG---CACCACGAT-TAATTGGTGGATGAG-TGCT--------TCTCGAGACCAATCGT-GCGTG-CCTCTCT---TCCGCGTTCGG-GCT-CCGTGACCCACGCG---TGTCGTCATG-----ACACCC-TTAA-CGAGA-CCTCAGGTCA Rafnia_alata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--AAGCA-GTG-TGACCC-GTG-AATTTGTTTG-ACC--ACTCA-GGGGTGG-CC----AGAGGTGT--TTGG-CTCCTC-GG-----TCCCC----CTCGTGCCGGGAGG-----CTCTCCGC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CTGAACGCGCC---AAGGAAATC--GAAA-TCGTTC-AGTGCGCC-CCCGTCAGCCC-GGAGACGGTG-CTT-GTG-CGGGCG-GTG--TTGCGACACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCCT-GGCCTCGC-GCT-------AGGCACCTA---GC--GGGGCGAATGCTGGCTTCCCGTGA-GCAAC---GCCTCACGGTTGGTTGAAAA-CTGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCGCCCC-CACCGGCATTGCG-ACT-CAATGGCCCATGAG---CGTCTTTTGG-----TCGCCC-AAGA-CGGGA-CCTCAGGT?? Rafnia_vlokii TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--AAGCA-GTG-TGACCC-GTG-AATTTGTTTG-ACC--ACTCG-GGGGTGG-CC----AGAGGTGT--TTGG-CTCCTC-GG-----TCCCC----CTCGTGCCGGGAGG-----CTCCCCCC-ACCTTGTGTGG----TCTCCTCCT-GGCCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTC-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CTT-GTG-CGGGGT-GTG--TTGCGAAACGCGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCC---AGTGCCCT-GGCCTTGC-GCC-------AGGCACCGA---GC--GGGGCGAATGCTGGCTTCCCGTGA-GCAAC---GCCTCACGGTTGGTTGAAAA-CCGAGTC-CGTGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GCGTG-TCGCCCC-CACCGGCATTGCG-ACT-CTATGGCCCATGAG---CGTCTGTTGG-----TCGCCC-AAGA-CGGGA-CCTCAGGT?? Retama_monosperma ???????????????????????TCG-AA-CC-T-CAA--AAGCA-GCG-TGACCCTGTG-AATTTGTTTG-AAT--ACTCA-GGGGTGG-CT----AGAGGTGT--TCTG-CATCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----TGCCCCC--ACCTTGTGTGG----TCTCCTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAAAT--GAAA-TCGTTT-AGTACGCC-CCTGTCGGCCC-GGAGACGGTG-ACC-GTG-CGGGCG-GTG--TTGCGACACGTAT------ATCC--------TAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TTTGCCTT-GGCCATGT-GCT-------AGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAGC---GTCTCACGGTTGGTTCAAAA-CTGAGTC-CGCGGTGT--AGGG---CACCGTGAT-GGAT-GGTGGTTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT--CGTGACCCATG???????????????????????????????????????????????? Retama_sphaerocarpa ???????????????????????TCG-AA-CC-T-CAC--AAGCA-GTG-TGACCCTGTG-AATTTGTTTG-ACT--ACTCAGGGGGTGG-AT----AGAGGTGT--TCGG-CATCTC-GG-----TCCCC----CTCGCGTCGGGAGG-----CGCCCCC--ACATTGTGAGG----TCTCCTCCT-GACCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTACGCC-CCCGTCGGCCC-GGAGACGGTG-ACC-GTG-CGGGCG-GCG--TTGCGACACGCGT------ATCC--------TAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TGTGCGTT-GGCCATGT-GCC-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGTGA-GCAGC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CACCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGGA-ATC--TGTGACCCATG???????????????????????????????????????????????? Sophora_tetraphylla ???????????????????????TCG-AATCC-T-CAC-AAAGAA-GTG-CGACCC-GTG-AATTTTGTTG-ACT--CCTCG-GGTGTGG-CTT----GAGGTGC--ATGG-CGCCTC-GG-----TCCCC----CTAGTGTTGGGAGG-----TGCCC----TCCTCGTGCGG----GCCCCTCCT-GGCCCAT-TAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--GAGA-TTGTCT-AGCACGCC-CCCGTCGG-TC-GGAGACGATG-ACT-GTG-TGG-TG-GCG--TTGCGACACGTGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---AATGCCTC-AGCCCTGTTGCT-------AGGCTTAGT--AAA--GGGGTGAATGTTGGCTTCCCGTGA-GCGAT---GCCTCACGGTTGGCTGAAAA-TTGAGTC-CGTGGTGG--AGTG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GTGTG-TCACCCC-TACCGGATTTGGG-ACT-CTTTGACCCATGAG---CGGCCGTTGG-----CTGCCC?????????????????????? Sophora_toromiro ???????????????????????TCG-AATCC-T-CAC-AAAGAA-GTG-CGACCC-GTG-AATTTGTTTG-ACT--CCTCG-GGTGTGG-CTT----GAGGTGC--ATGG-CGCCTC-GG-----TCCCC----CTAGTGTTGGGAGG-----TGCCC----TCCTCGTGCGG----GCCCCTCCT-GGCCCAT-TAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--GAGA-TTGTCT-AGCACGCC-CCCGTCGGCTC-GGAGACGATG-ACT-GTG-TGG-TG-GCG--TTGCGACACGTGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---AATGCCTC-AGCCCTGTTGCT-------AGGCTTAGT--AAA--GGGGTGAATGTTGGCTTCCCGTGA-GCGAT---GCCTCACGGTTGGCTGAAAA-TTGAGTC-CGTGGTGG--AGTG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------GCTCGAGACCGATCGT-GTGTG-TCACCCC-TACCGGATTTGGG-ACT-CTTTGACCCATGAG---CGGCCGTTGG-----CTGCCC?????????????????????? Spartium_junceum ???????????????????????TCG-AAGCC-T-TAA--AAGCA-GTG-CGACCTCGTG-AATTTGTTTG-ACT--ACTTA-GGGGTGA-CT----AGAGGTTT--TCGG-CACCTC-GG-----TCCCC----CTCGTGTCGGGAGG-----TAGCAC---ACCTTGTGTGG----TCTCCTCCG-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGATATT--GAAA-TCGTCT-AGTGCACC-CTCGTCAGCCC-GGAGACGGTG-CCT-GTG-CGGGTG-GTG--TTGCGACACGTGT------ATCC--------GAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TATGCCTT-AGCCACGT-GCT-------ATGCATTGA---TT--TGGGCGTATGTTGGCTTCCCGTGA-GCAGT---GTCTCACGGTTGGTTGAAAT-TTGAGTC-TGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAA-------GCTCGAGACCGATCGT-GCGTA-TCACCCC-CACCAGCTTTGTG-ACT-CTGTGACCCATGGG---GGTCTGTTGG-----CCCCTT?????????????????????? Sphaerolobium_minus ???????????????????ATTGTCA-ATGCC-T-CAC--AAGCA-GCT-AAACCC-GTG-AATGTGTTTT-TCT-ATTTAA--GGTTGG-TT----TGCAGTG--TTTAA-CATTGC-AA-----CCTCC----CTCATGCTGGGAGG--ATATGCTC----ACCTGGTGAGT----TCACCTCCT-AGCTAAAA---C---AAAACCCCGGCG--CTGAATGCGCC---AAGGAACCT---AAT-TTGTTC-AGTGCGCC-CCCGTAGACCC-GGAGACGGTG-CTT-TTG-CGGGTG-GCG--TTGTGACATGTGAAA----ATTT--------AAATGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTAAGGGCACGCCTGCCTGGGTGTCACACATTGTTGCCCT---AA-GCCAA-T-CTGTGCAAAT------GGATTTGAGC---AT--AGGGTGAATGTTGGCTTCCCGTGA-GCATT---GCCTTGCGGTTAGTTGAAAA-TTTAGTC-CATGGTGG--AGTG---CACCATGAT--AGATGGTGGATGAG-TTTA--------TCTCGAGACCAATCAT-GTGTG-TCCCTCT--ATTGTATTTGGA-CTT-?CGTGACCCTCTTG---TGTCCATTGG-----ACACCC-ATCA-TGAGA-CCTCAGGTCA Sphaerolobium_nudiflorum ???????????????????ATTGTTG-ATGCC-T-CAC--AAGCA-GCG-TAACAT-GT--AATGTTATTCTACT--TAAGA----TTGG-TT----GGGCGTG--TTTAA-CACCAT-AA-----TCTCC----CTTGTGCCGGGAAG--ATATTCTC----ACGTTGTGGAC----TCTCCTCCC-AGCTAAA----C---AAAACCTCGACG--CTGAATGCGCC---AATGAACCT---AAT-TTGTTT-AGTGCGCC-CTCAGAGACCC-GAAGACGGTG-CTT-TTG-CCGGTG-GCA--TGTGGAATTGAAAAA----AATA-------AGA-TGACTCTCGGCAACAGATATCTCGGCTCATG-CACCGCTGAAGAA-TATAGCGAAATGCGATACTTCGTGTGAATTGCAGAATCTAGTGAACCATTGAGTCTTTGAA-CGCAGGTTGCGCCCGAA-GCCATTAGGATAAAGGCACGCCTACTTGGGTGTCACACATTGTTGCCCC---AA-GTCAA-T-CTGCACAACT------AGTTCTGTGC---AT--GGGGTGAATGTTGGCTTCCCGTGA-GCATC---GTCTTGCGGTTGGCTGAAAA-TTGAGTC-CATGGTGG--AGTG---TACCATGAT--ACATGGTGGTTGAG-TATA--------GCTCAAGACCAATCAT-GCCTA-TCTTTTT--GTTATGTTTGGA-TTT--TGTGACCCATGTG---TGTCTATCGG-----ACACCC-ATC--TGTGA-CCTCAAGTCA Stauracanthus_genistoides_genistoides ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTC-TCT--ACTCAAGGGGTGG-CT----AGAGGTGC--TCG--CACATC-GG-----CCCCC-----TCGTGTCGGGAGG-----TGCTCC---ACCTTGTGTGT----TGTCTTCCT-GGCCTAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CTGGTG-GCG--TTGCGACACGCGA------ATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCGTTGCCCC---TGTGCCTT-GGCCACGT-GCT-------AGGCATCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAGC---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CACCGTGAT-GGAT-GGTGGCTGAG-TTAAT-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCAGCTTTGCG-ACT-CTGTGACCCATGGG---GGTCTGTTGA-----TCGCCT-AAGA-CGGGAACCTCAGG??? Stirtonanthus_chrysanthus TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----AGAGGTGT--TTTG-CACC{AC}C-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAACA-----TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGCCCGTTGG-----TCGCCC-ATGA-CGGGA-CCTCAGGT?? Stirtonanthus_insignis TGAACGTGCGG-GATGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACC--GCGAAATTTGTTTG-ACT--ACTCA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGCGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TTGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGCG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCC-ATGA-CGGGA-CATCAG-T?? Stirtonanthus_taylorianus TGAAC-TGCGGGAAGGATCATTGTCG-AAGCC-TGCAC--GATCA-GAG-CGACC--GGGGAATTTGTTTG-AAT--ACTCA-GGGGCGG-CT----AGAGGTGT--TTTG-CACCAC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGCCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---AATGCCTT-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGTGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAACA-----TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGCCCGTTGG-----TCGCCC-ATGA-CGGGA-C-TCAGGT?? Styphnolobium_japonicum ???????????????????????TCG-ATGCT-T-AAC--AAGCT-GTA-CGACCG-TGC-AATTTGTTAT-ACT--A-TC--GGGGCGG-CTC----AGGGTGT--TTGA-CACCTC-GA------ACCC----CCTAAGCCAGGAGG-----CGCCC----ACCTCGTGTGG----TTTCCTTCT-GGCCCAAACAAC----AAACCACGGCGCCCAAAATGAGCCCCCAAGGAACTCCCCAAT-TTGTTTAAGTGCGCT-CCCGTCGACCC-GGACACGGTA-CTC-GTG-TCGGTG-GGG-GATGCGACATATGTT-----ATCT-------AAAATGACTCTCGGCAACGGATATCTCGGCTCTTGTCATCGATGAAGAA-CGTAGCGAAATGCGATACTAGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATCGCAAGTTGCGCCCGAAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTTGCCCC---AATGCCAG-TGCCTCTTGTCT-------AGGTCCTGA---GC--GGGGCGAATGTTGGCTTCCCGTGAAGCCTT---GTCTCGCGGTTGGGTAAAAAA-TGTGTC-TGTGGTGG--AGAG--ACACCACGAT-GGAT-GGTGGCTGAG-TAAAA-------TCTCGAGACCAATCGC-GTGTG-TCTCCTT--GCCGGTTTTGG--ACT-ATGTGACCCACGGAACATCATATACGA-----TCGCCC?????????????????????? Templetonia_retusa ????????????????????????????????-T-CAC--AAGCA-GCG-CGACTC-GCG-AATTTGTTTG-ACT--TGATT-GGGACGGGC-----AGGGGTGC--TCGA-CGCCTC-GG-----CCCCC----CCGGTGCTGGAAGG-----TGCCT----GCCTCGTGCGG----TCTCCGCCC-GGCCGA--AAATAACCAAACCCCGGCG--CCGAATGCGCC---AAGGAACTC--GAAA-TCGTTC-GGTGCGTC-CCCGTCGGCCC-GGAGACGGTG-CCC-GCG-CGGGG--GTG--TCGCGACA--CGCG-----AATTAAAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCCCG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC---ATTCCCGG-TGCCTCGT-CGC-------AGGCGCCGTGGGAT--GTGGCGAATGCTGGCTTCCCGGGA-GCACC---GTCTCGCGGTTGGCTGAAAG-TCGAGCC-CGTGGTGG--AGTG---CACCGCGAC-GGAT-GGTGGTTGAG-GGTA--------ACTCGAGACCAGTCGC-GCGCG-TCGGCC---TCCCCGTTTCGGGACT-CTGTGACCCACGAG---CGGCATTCGG-----TCGCCC-ACAA-CGGGA-CCTCAGGTCA Thermopsis_divaricarpa ???????????????????????TCG-AAGCC-T-AAC-AATGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTAA-GGGGTGG-CC----AGAGGTGT--TCGG-CACCTC-GG-----TACCC---CATTGTGTC-AGAAG-----AGCCCG---TCCTTGTGCGG----TCTACTCCT-GGCCTTA-TAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--AAGA-TTGTCT-AGTGCGTC-CCTGTTGGCACCGGAGACGGTG-CCG-TTG-CGGGTG-GCG--TTGTGACACGCAT------ATCC--------CAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAA-CGCAAGTTGCGCCCGAA-GCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC--AAATGCCTC-AGCCTTGT-GCT-------AGGCTTCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCTAT---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGTGGTGG--AGGG---TGCCGCGAT-GCAT-GGTGGTTGAG-TAAAA-------GCTCGAGTTCGATCGT-GCGCG-TCACCCC-TATCGGATTTGGG-ACT-CTGTGACCCATGAG---CGTCTGTTGG-----TTGCCC?????????????????????? Thermopsis_montana ???????????????????????TCG-AAGCC-T-AAC-AATGCA-GTG-CGACCC-GCG-AATTTGTTTG-ACT--ACTAA-GGGGTGG-CT----AGAGGTGT--TCGG-CACCTC-GG-----TACCC---CATTGTGTC-AGAGG-----AGCCCG---TCCTTGTGTGG----TCTCCTCCT-GGCCTTA-TAAC---AAAACCCCGGCG--CCGAATGCGCC---AAGGAAATC--AAGA-TTGTCT-AGTGCGTC-CCCGTTGGCACCGGAGACGGTG-CCG-CTG-CGGGTG-GCG--TTGTGACACGCAT------ATCC--------CAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCGTTGAA-CGCAAGTTGCGCCCGAA-GCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCC--AAATGCCTC-AGCCTTGT-GCT-------AGGCTTCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCTAT---GTCTCACGGTTGGTTGAAAA-TTGAGTC-CGTGGTGG--AGGG---TGCCGCGAT-GCAT-GGTGGTTGAG-TAAAA-------GCTCGAGTTCGATCGT-GCGCG-TCACCCC-TATCGGATTTGGG-ACT-CTGTGACCCATGAG---CGTCTGTTGG-----GTGCCC?????????????????????? Ulex_densus ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTA-ACT--ACTCA-GGGATGG-CT----AGAGGTGT--TCG--CACCTC-GG-----TCCCC----CTCGTGTCGGGATG-----TGCTCC---ACCTTGTGTGT-----GTCTTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGAG-GCG--TTGCGACACGCGA------ATCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATCGTTGCCCC---TGTGCCTT-GGCCATGT-CTT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCATT---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAT-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CACTAGCTTTGTG-ACT-TTGTGACCCATGGG---GATCTGTTGA-----TCACCC?????????????????????? Ulex_parviflorus ???????????????????????TCG-AAGCC-T-CAC--AAGCA-GTG-CGACCC-GTG-AATTTGTTTA-ACT--ACTCA-GGGATGG-CT----AGAGGTGT--TCG--CACCTC-GG-----TCCCC----CTCGTGTCGGGATG-----TGCTCC---ACCTTGTGTGT----TGTCTTCCT-GGCCCAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCC-CCCGTCGGCCC-GGAGACGGTG-CCC-GTG-CGGGAG-GCG--TTGCGACACGCGA------ATCC--------TAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCC---TGTGCCTT-GGCCATGT-CCT-------AGGCACCGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCATT---GTCTCACGGTTGGTTGAAAA-CTGAGTC-CGCGGTGG--AGGG---CGCCGTGAT-GGAT-GGTGGCTGAG-TTAAT-------TCTCGAGACCAATCGT-GTGTG-TCACCCC-CACTAGCTTTGTG-ACT-TTGTGACCCATGGG---GATCTGTTGA-----TCGCCC?????????????????????? Virgilia_divaricata TGAAC-TGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--AATCA-GAG-CGACC--GCG-AATTTGTTTG-ACT--ACTGA-GGGGCGG-CT----AGACGTGT--TATG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCC-CCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGACATC--GAAA-TCGTTT-AGTGCACCACCCGCCGGCTC-GGAGAGGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCTCC--AATGCCTT-GGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGTCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCT-ATGA-CGG-A-CCTCA-GT?? Virgilia_oroboides_ferruginea TGAACTTGCGGGAAGGATCATTGTCG-AAGCC-T-CAC--AATCACGAG-CGACC--GCGGAATTTGTTTG-ACT--ACTGA-GGGGCGG-CT----AGACGTGT--TATG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGACATC--GAAA-TCGTTT-AGTGCACCACCCGCCGGCTC-GGAGAGGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCTCC--AATGCCTT-GGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGATGGGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGTCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----TCGCCT-ATGA-CGGGA-CCTCAGGT?? Virgilia_oroboides_oroboides TGAAC-TGCGG-AAG--TCATTGTCG-AAGCC-T-CAC--AATCA-GAG-CGACCC-GCG-AATTTGTTTGAACT--ACTGA-GGGGCGG-CT----AGACGTGTA-TATG-CACCTC-GG-----TCCCC----CTTGTGTTGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCTGGACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCACCACCCGCCGGCTC-GGAGAGGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCATTAGGCCAAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCTCC--AATGCCTT-GGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACGTCCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCCTTGG-----TCGCCT-AGGA-TTGGA-CAAC-GG??? Xiphotheca_canescens TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCCC-GG-----CCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCA-CGGCGGTC-------TCCTCCT-GACCAAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATAGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_cordifolia TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-T-G-CGACCC-GCG-AATATGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----CCCCC----CTTGTGTCGGGAGG-----CGTCGCTGCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GTGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_elliptica TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGA-CT---AAGAGGTGT--TCTG-CACCTC-GG---TGTCCCC----CTTGTGTCGGGAGG-----TGTCGCTCCA-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGTACGCGCC---AAGGAAATT--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCCACATGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_guthriei ??????????????????CATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG----GCCCCC----CTTGTGTCGGGAGG-----TGTCGCTGCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCTCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_lanceolata TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GTG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----TCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGATG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GAGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_phylicoides TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG-----CCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCA-CGGCGGTC-------TCCTCCT-GACCAAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGTCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_reflexa TGAACCTGCGG-AAGGATCATTGTCG-AAGCC-T-CAC--GATCA-GAG-CGACCC-GCG-AATTTGTTTG-ACT--ACTCA-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTC-GG----GCCCCC----CTTGTGTCGGGAGG-----TGTCGCTGCT-CGGCGGTC-------TCCTCCT-GACCGAA-TAAC---AAAACCCCGGCG--CCGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------ATCC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCTCC--AATGCCTC-AGCCTTGT-GCT-------AGGCACTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGGCTTTGGG-ACT-CTGTGACCCATGAG---CGTCCGTTGG-----GCGCCC-ATGA-CGGGA-CCTCAGGT?? Xiphotheca_tecta TGAAC-TGCGG-AAGGATCATAGTCG-AAGCC-T-CAC--GATCA-GAG-CGACC--GCGGAATTTGTTTG-ACT---CTTG-GGGGCGG-CT---AAGAGGTGT--TCTG-CACCTA-GG-----CCCCC----CTTGTGTCGGGAGG-----CGTCGCTCCA-CGGCGGTC-------TCCTCCT-GACCAAA-TAAC---AAAACCCCGGCG--CTGAACGCGCC---AAGGAAATC--GAAA-TCGTTT-AGTGCGCCACCCGTCGGCTC-GGAGACGGTG-CTC-GTG-CGGGTG-GTG--TTGCGACACGCGT------CACC--------AAAAGACTCTCGGCAACGGATATCTCGGCTCTTG-CATCGATGAAGAA-CGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAA-CGCAAGTTGCGCCCGAA-GCCTTTAGGCCGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCC--AATGCCTT-AGCCTTGT-GCT-------AGGCATTGA---GC--GGGGCGAATGTTGGCTTCCCGCGA-GCAAA---GCCTCACGGTTGGTTGAAA-GTTGAGTT-CGTGGTGG--AGGG---CGCCGCGAT-GGAT-GGTGGTTGAG-TAAAA-------TCTCGAGACCGATCGT-GCGTG-TCACCCC-CACCGTCTTTGGG-ACT-CTGTGACCCATGAG---CGTTCGTTGG------CGCCC-ATGA-CGGGA-CCTCAGGT?? ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'HighLevel_ITS') = N: 1-788; CODONPOSSET CodonPositions (CHARACTERS = 'HighLevel_ITS') = N: 1-788; END; [ The following blocks are output data for analysis step 3958 ] BEGIN TREES; TITLE Tb8730; LINK TAXA = TaxaForAnalysisStep3958; TREE Fig._4 = [&R] ((((((((((((((((((((((((((Amphithalea_alba,Amphithalea_tomentosa),Amphithalea_virgata),Amphithalea_violacea),((Amphithalea_ericifolia,Amphithalea_stokoei),Amphithalea_oppositifolia)),Amphithalea_speciosa),Amphithalea_intermedia),Amphithalea_phylicoides),Amphithalea_biovulata),(Amphithalea_axillaris,Amphithalea_rostrata)),Amphithalea_fourcadei),(Amphithalea_cuneifolia,Amphithalea_imbricata)),(Amphithalea_michrantha,Amphithalea_williamsonii)),((Amphithalea_ciliaris,Amphithalea_flava),((Amphithalea_dahlgrenii,(Amphithalea_monticola,Amphithalea_muraltioides,Amphithalea_obtusiloba,Amphithalea_parvifolia,Amphithalea_spinosa,Amphithalea_tortilis),Amphithalea_muirii,Amphithalea_pageae,Amphithalea_villosa,Amphithalea_vlokii),Xiphotheca_elliptica,Xiphotheca_lanceolata))),(((Xiphotheca_canescens,Xiphotheca_tecta),Xiphotheca_phylicoides),(Xiphotheca_cordifolia,(Xiphotheca_guthriei,Xiphotheca_reflexa)))),(((Calpurnia_aurea,Calpurnia_glabrata,(Calpurnia_sericea_x_woodii,Calpurnia_woodii)),Calpurnia_sericea),Calpurnia_intrusa)),((((Virgilia_divaricata,Virgilia_oroboides_ferruginea),Virgilia_oroboides_oroboides),((((((((((((((((Liparia_angustifolia,Liparia_hirsuta),Liparia_confusa),Liparia_racemosa),Liparia_genistoides),(Podalyria_burchelli,Podalyria_buxifolia,Podalyria_cordata,Podalyria_hirsuta,Podalyria_intermedia,Podalyria_lanceolata,(Podalyria_oleaefolia,Podalyria_speciosa),Podalyria_orbicularis,Podalyria_rotundifolia)),((((Podalyria_argentea,(((Podalyria_cuneifolia,(Podalyria_myrtillifolia,Podalyria_variabilis)),Podalyria_microphylla),Podalyria_pearsonii)),Podalyria_leipoldtii),Podalyria_biflora),Podalyria_sericea)),Liparia_rafnioides),Podalyria_calyptrata),Liparia_vestita),Liparia_boucheri),Podalyria_canescens),Liparia_myrtifolia),Liparia_bonaespei,Liparia_latifolia),(((Liparia_calycina,(Liparia_capitata,Liparia_congesta)),(((Liparia_parva,Liparia_splendens_comantha),Liparia_splendens_splendens),Liparia_striata)),Liparia_umbellifera)),(Stirtonanthus_chrysanthus,Stirtonanthus_taylorianus)),Stirtonanthus_insignis)),((((Cyclopia_alopecuroides,Cyclopia_bolusii),(((((Cyclopia_alpina,Cyclopia_maculata),Cyclopia_sessiliflora),Cyclopia_plicata),(Cyclopia_burtonii,Cyclopia_pubescens)),((Cyclopia_aurescens,(((Cyclopia_falcata,Cyclopia_genistoides),Cyclopia_longifolia),Cyclopia_subternata)),Cyclopia_intermedia))),Cyclopia_galioides),(Cyclopia_glabra,Cyclopia_meyeriana)))),(((Cadia_commersoniana,Cadia_purpurea),Cadia_pubescens),Cadia_pedicellata)),(((((((Rafnia_vlokii,Rafnia_alata),((Aspalathus_corrudifolia,Aspalathus_cordata),Lebeckia_sessilifolia)),Lebeckia_wrightii),(Lotononis_laxa,Lotononis_alpina)),(Pearsonia_grandifolia,Pearsonia_sessilifolia)),(Crotalaria_pallida,Crotalaria_capensis)),(((Melolobium_adenodes,Melolobium_candicans),((((Argyrolobium_lunare,(Lupinus_polyphyllus,Lupinus_arcticus)),(Argyrolobium_harmsianum,((((((Retama_monosperma,Retama_sphaerocarpa),(((Ulex_parviflorus,Ulex_densus),Stauracanthus_genistoides_genistoides),Ecinospartum_boissieri)),(((Spartium_junceum,Erinacea_anthyllis),Genista_tournefortii),Genista_teretifolia)),Argyrocytisus_battandieri),((Laburnum_anagyroides,Cytisophyllum_sessilifolium,(Heperolaburnum_platycarpum,Calicotome_villosa)),Adenocarpus_viscosus)),Petteria_ramentacea))),Polhillia_pallens),Anarthrophyllum_cumingii)),Dichilus_strictus))),((((((Thermopsis_montana,Thermopsis_divaricarpa),Baptisia_australis),Baptisia_tinctoria),(Anagyris_foetida,Piptanthus_tomentosus)),(Sophora_toromiro,Sophora_tetraphylla)),Maackia_amurensis)),((Styphnolobium_japonicum,Pickeringia_montana),(Baphia_madagascariensis,(((Hypocalyptus_colutioides,Hypocalyptus_sophoroides),Hypocalyptus_oxalidifolius),(((((((((Mirbelia_longifolia,Leptosema_daviesioides),(Jacksonia_alata,Jacksonia_macrocalyx)),(((Aotus_cordifolia,Aotus_carinata),Pultenaea_stipularis),(Nemcia_plicata,Podolobium_aciculiferum))),Pultenaea_pedunculata),(Chorizema_varium,Chorizema_aciculare)),Mirbelia_specosa),Oxylobium_cordifolium),(Isotropis_foliosa,Isotropis_forrestii)),((Daviesia_mimosoides,(Sphaerolobium_minus,Sphaerolobium_nudiflorum)),(((Bossiaea_lenticularis,Bossiaea_lonophylla),(Goodia_medicaginea,Goodia_latifolia)),(Muelleranthus_trifoliolatus,Aenictophyton_reconditum)))))))),Bolusanthus_speciosus),Diplotropis_martiussii),Acosmium_panamense),Cyclolobium_nutans),(Brongniartia_alamosana,(Hovea_elliptica,Templetonia_retusa))),Poecilanthe_falcata); [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr2918] END;