#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on April 07, 2020; 23:35 GMT TreeBASE (cc) 1994-2008 Study reference: Bayha K.M., & Dawson M.N. 2010. A new family of allomorphic jellyfishes, Drymonematidae (Scyphozoa, Discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton. Biological Bulletin, 219(3). TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S10857] [ The following blocks are input data for analysis step 6418 ] BEGIN TAXA; TITLE TaxaForAnalysisStep6418; DIMENSIONS NTAX=14; TAXLABELS Drymonema_dalmatinum_M0D13158B Drymonema_dalmatinum_M0D15768L Drymonema_dalmatinum_M0D15769M Drymonema_dalmatinum_M0D15770N Drymonema_dalmatinum_M0D15771O Drymonema_larsoni_M0D14609W Drymonema_larsoni_M0D15759C Drymonema_larsoni_M0D15761E Drymonema_larsoni_M0D15762F Drymonema_larsoni_M0D15765I Drymonema_larsoni_M0D15767K Drymonema_larsoni_M0D16430X Drymonema_larsoni_M0D16431Y Drymonema_larsoni_M0D16432Z ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M6587] TITLE Drymonematidae_COI; LINK TAXA = TaxaForAnalysisStep6418; DIMENSIONS NCHAR=595; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Drymonema_dalmatinum_M0D13158B CCTCTATTTAGTATTTGGGGCGTTCTCAGCCATGATAGGAACTTCATTTAGCATGATTATAAGACTTGAATTATCAGGTCCAGGCTCAATGCTAGGAGATGACCAAATCTACAATGTTGTAGTAACAGCCCATGCTTTAGTAATGATATTTTTCTTTGTAATGCCTGTCCTAATAGGTGGATTCGGGAATTGATTAGTACCATTATTTATAGGAAGCCCAGATATGGCCTTCCCAAGATTAAATAACATAAGTTTTTGACTTTTACCTCCTGCTTTATTATTATTGCTAGGATCTTCCTTAATAGAACAAGGAGCTGGAACGGGGTGAACAATTTACCCACCACTATCTTCCATACAATCCCATTCAGGAGGTTCAGTAGATATGGCTATATTTAGTTTACATTTAGCGGGAGCTTCTTCAATAATGGGAGTTATAAACTTCATAACTACTATTATTAACATGAGAGCTCCCGGTATAACCATGGACAGACTACCTTTATTTGTATGATCTGTACTAGTAACGGCCGTATTATTACTACTATCTTTACCAGTACTAGCTGGAGCTATAACAATGTTGTTAACAGATAGGAATTTT Drymonema_dalmatinum_M0D15768L -----------------GGGCGTTCTCAGCCATGATAGGAACTTCATTTAGCATGATTATAAGACTTGAATTATCAGGTCCAGGCTCAATGCTAGGAGATGACCAAATCTACAATGTTGTAGTAACAGCCCATGCTTTAGTAATGATATTTTTCTTTGTAATGCCTGTCCTAATAGGTGGATTCGGGAATTGATTAGTACCATTATTTATAGGAAGCCCAGATATGGCCTTCCCAAGATTAAATAACATAAGTTTTTGACTTTTACCTCCTGCTTTATTATTATTGCTAGGATCTTCCTTAATAGAACAAGGAGCTGGAACAGGGTGAACAATTTACCCACCACTATCTTCCATACAATCCCATTCAGGAGGTTCAGTAGATATGGCTATATTTAGTTTACATTTAGCGGGAGCTTCTTCAATAATGGGAGTTATAAACTTCATAACTACTATTATTAACATGAGAGCTCCCGGTATAACCATGGACAGACTACCTTTATTTGTATGATCTGTACTAGTAACGGCCGTATTATTACTACTATCTTTACCAGTACTAGCTGGAGCTATAACAATGTTGTTAACAG----------- Drymonema_dalmatinum_M0D15769M CCTCTATTTAGTATTTGGGGCGTTCTCAGCCATGATAGGAACTTCATTTAGCATGATTATAAGACTTGAATTATCAGGTCCAGGCTCAATGCTAGGAGATGACCAAATCTACAATGTTGTAGTAACAGCCCATGCTTTAGTAATGATATTTTTCTTTGTAATGCCTGTCCTAATAGGTGGATTCGGGAATTGATTAGTACCATTATTTATAGGAAGCCCAGATATGGCCTTCCCAAGATTAAATAACATAAGTTTTTGACTTTTACCTCCTGCTTTATTATTATTGCTAGGATCTTCCTTAATAGAACAAGGAGCTGGAACGGGGTGAACAATTTACCCACCACTATCTTCCATACAATCCCATTCAGGAGGTTCAGTAGATATGGCTATATTTAGTTTACATTTAGCGGGAGCTTCTTCAATAATGGGAGTTATAAACTTCATAACTACTATTATTAACATGAGAGCTCCCGGTATAACCATGGACAGACTACCTTTATTTGTATGATCTGTACTAGTAACGGCCGTATTATTACTACTATCTTTACCAGTACTAGCTGGAGCTATAACAATGTTGTTAACAGATAGGAATTTT Drymonema_dalmatinum_M0D15770N CCTCTATTTAGTATTTGGGGCGTTCTCAGCCATGATAGGAACTTCATTTAGCATGATTATAAGACTTGAATTATCAGGTCCAGGCTCAATGCTAGGAGATGACCAAATCTACAATGTTGTAGTAACAGCCCATGCTTTAGTAATGATATTTTTCTTTGTAATGCCTGTCCTAATAGGTGGATTCGGGAATTGATTAGTACCATTATTTATAGGAAGCCCAGATATGGCCTTCCCAAGATTAAATAACATAAGTTTTTGACTTTTACCTCCTGCTTTATTATTATTGCTAGGATCTTCCTTAATAGAACAAGGAGCTGGAACAGGGTGAACAATTTACCCACCACTATCTTCCATACAATCCCATTCAGGAGGTTCAGTAGATATGGCTATATTTAGTTTACATTTAGCGGGAGCTTCTTCAATAATGGGAGTTATAAACTTCATAACTACTATTATTAACATGAGAGCTCCCGGTATAACCATGGACAGACTACCTTTATTTGTATGATCTGTACTAGTAACGGCCGTATTATTACTACTATCTTTACCAGTACTAGCTGGAGCTATAACAATGTTGTTAACAGATAGGAATTTT Drymonema_dalmatinum_M0D15771O CCTCTATTTAGTATTTGGGGCGTTCTCAGCCATGATAGGAACTTCATTTAGCATGATTATAAGACTTGAATTATCAGGTCCAGGCTCAATGCTAGGAGATGACCAAATCTACAATGTTGTAGTAACAGCCCATGCTTTAGTAATGATATTTTTCTTTGTAATGCCTGTCCTAATAGGTGGATTCGGGAATTGATTAGTACCATTATTTATAGGAAGCCCAGATATGGCCTTCCCAAGATTAAATAACATAAGTTTTTGACTTTTACCTCCTGCTTTATTATTATTGCTAGGATCTTCCTTAATAGAACAAGGAGCTGGAACGGGGTGAACAATTTACCCACCACTATCTTCCATACAATCCCATTCAGGAGGTTCAGTAGATATGGCTATATTTAGTTTACATTTAGCGGGAGCTTCTTCAATAATGGGAGTTATAAACTTCATAACTACTATTATTAACATGAGAGCTCCCGGTATAACCATGGACAGACTACCTTTATTTGTATGATCTGTACTAGTAACGGCCGTATTATTACTACTATCTTTACCAGTACTAGCTGGAGCTATAACAATGTTGTTAACAGATAGGAATTTT Drymonema_larsoni_M0D14609W CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGACTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCCCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTGCATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGATCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D15759C CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGGACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGGTCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D15761E CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGATCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D15762F CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGACTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCCCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGATCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D15765I CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGATCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D15767K CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGGTCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D16430X CCTTTACCTAGTATTTGGAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGATCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAGATAGGAACTTT Drymonema_larsoni_M0D16431Y -----------------GAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGGTCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAG----------- Drymonema_larsoni_M0D16432Z -----------------GAGCGTTCTCAGCCATGATAGGAACTTCATTTAGTATGATCATAAGACTTGAATTATCAGGTCCAGGCTCAATGTTAGGGGACGACCAAATCTACAATGTTGTAGTAACAGCCCACGCCCTAGTAATGATATTCTTCTTTGTAATGCCAGTTTTAATAGGGGGATTCGGAAATTGATTAATCCCATTATTTATAGGGAGTCCAGATATGGCATTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCTCCTGCCTTGTTGTTATTATTAGGATCCTCTCTAATAGAGCAAGGGGCTGGAACAGGATGAACACTTTATCCACCACTAGCATCTATTCAATCCCATTCAGGAGGTTCGGTAGATATGGCTATATTCAGTTTACATTTAGCAGGAGCCTCGTCAATAATGGGAGTTATAAATTTTATAACCACCATAATTAATATGAGAGCCCCTGGTATAACTATGGATAGGTTACCTTTGTTTGTATGGTCTGTATTAGTAACTGCTGTGTTATTGTTATTATCCTTACCAGTATTGGCAGGAGCAATAACAATGTTACTAACAG----------- ; END; [ The following blocks are output data for analysis step 6418 ] BEGIN TREES; TITLE Drymonematidae_COI_TB; LINK TAXA = TaxaForAnalysisStep6418; TREE Figure_9A = [&R] ((((Drymonema_larsoni_M0D15761E:9.999999994736442E-9,(Drymonema_larsoni_M0D15765I:9.999999994736442E-9,Drymonema_larsoni_M0D16430X:9.999999994736442E-9):9.999999994736442E-9):9.999999994736442E-9,(Drymonema_larsoni_M0D15759C:0.001685909999999985,((Drymonema_larsoni_M0D16431Y:9.999999994736442E-9,Drymonema_larsoni_M0D16432Z:9.999999994736442E-9):9.999999994736442E-9,Drymonema_larsoni_M0D15767K:9.999999994736442E-9):9.999999994736442E-9):0.0016864099999999993):0.0018974900000000017,(Drymonema_larsoni_M0D15762F:9.999999994736442E-9,Drymonema_larsoni_M0D14609W:0.0016815500000000039):0.001476840000000007):0.07156341,((Drymonema_dalmatinum_M0D15768L:9.999999994736442E-9,Drymonema_dalmatinum_M0D15770N:9.999999994736442E-9):9.999999994736442E-9,(Drymonema_dalmatinum_M0D15769M:9.999999994736442E-9,(Drymonema_dalmatinum_M0D15771O:9.999999994736442E-9,Drymonema_dalmatinum_M0D13158B:9.999999994736442E-9):9.999999994736442E-9):0.00167813):0.07156341); [! TreeBASE tree URI: http://purl.org/phylo/treebase/phylows/tree/TB2:Tr21497] END;