@ARTICLE{TreeBASE2Ref21345,
author = {Elisabeth Baloch and Gunnar Gilenstam and Mats Wedin},
title = {The relationships of Odontotrema (Odontotremataceae) and the resurrected Sphaeropezia (Stictidaceae) ? new combinations and three new Sphaeropezia species},
year = {2013},
keywords = {Ascomycetes, Bryodiscus, Coccomycetella, Lethariicola, Odontotremataceae, Ostropales, Ostropomycetidae, Stictidaceae, taxonomy},
doi = {},
url = {http://},
pmid = {},
journal = {Mycologia},
volume = {105},
number = {2},
pages = {384--397},
abstract = {Odontotremataceae is polyphyletic and constitutes two distantly related clades, the true Odontotremataceae and a segregate group within Stictidaceae including "Odontotrema" cassiopes, "O." diffindens, lichenicolous "Odontotrema" species and "Bryodiscus" arctoalpinus. Sphaeropezia is here accepted as the name for this latter group. An updated phylogeny of the Stictidaceae based on mtSSU, nuLSU and the protein coding gene RPB2 is presented together with a taxonomic revision of Swedish taxa of Odontotrema and Sphaeropezia. Bryodiscus and Lethariicola are synonymized under Sphaeropezia, and three new Sphaeropezia species are described: the lignicolous S. capreae, the fungicolous S. lyckselensis, and the lichenicolous S. mycoblasti. The new species are distinguished from other species by molecular and morphological characters, and substrate preferences. The new combinations Sphaeropezia arctoalpina, S. cassiopes, S. grimmiae, S. hepaticarum, S. melaneliae, S. ochrolechiae and S. thamnoliae are proposed. The morphology of these species was studied in detail. We further propose to combine the remaining lichenicolous Odototrema species, exept O. stereocaulicola, in Sphaeropezia based on their close relationship to the studied lichenicolous taxa. These additional new combinations include Sphaeropezia bryoriae, S. cucularis, S. figulina, S. intermedia, S. japewiae, S. lecanorae, S. navarinoi, S. pertusariae, S. rhizocarpicola, S. santessonii, and S. sipei. A lectotype is designated for the name Odontotrema diffindens Nyl.}
}
Matrix 14393 of Study 13372
Citation title:
"The relationships of Odontotrema (Odontotremataceae) and the resurrected Sphaeropezia (Stictidaceae) ? new combinations and three new Sphaeropezia species".
Study name:
"The relationships of Odontotrema (Odontotremataceae) and the resurrected Sphaeropezia (Stictidaceae) ? new combinations and three new Sphaeropezia species".
This study is part of submission 13372
(Status: Published).
Matrices
Title: Balochetal Sphaeropezia LSU MP
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Sphaeropezia arctoalpina |
(none)
|
------------------------------ |
Sphaeropezia capreae 1 |
(none)
|
------------------------------ |
Sphaeropezia capreae 2 |
(none)
|
------------------------------ |
Sphaeropezia lyckselensis 1 |
(none)
|
------------------------------ |
Sphaeropezia lyckselensis 2 |
(none)
|
------------------------------ |
Sphaeropezia lyckselensis 3 |
(none)
|
------------------------------ |
Sphaeropezia ochrolechiae |
(none)
|
------------------------------ |
Sphaeropezia mycoblasti |
(none)
|
------------------------------ |
Carestiella socia |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Cryptodiscus foveolaris |
(none)
|
TTGACCTCGGATCAGGTAGGATTACCCGCT |
Cryptodiscus pallidus |
(none)
|
TCGACCTCGGATCAGGCAGGATTACCCGCT |
Cryptodiscus pini |
(none)
|
TCGACCTCGGATCAGGCAGGATTACCCGCT |
Ostropa barbara |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Schizoxylon albescens |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Stictis radiata |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Odontotrema phacidioides |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Odontotrema phacidiellum |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Coccomycetella richardsonii |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Graphis scripta |
(none)
|
TCGACCTCGGATCAGATAGG-ATACCCnnn |
Thelotrema lepadinum |
(none)
|
TCGACCTCGGATCAAGTAGGGATACCCGCT |
Gyalecta jenensis |
(none)
|
------------------------------ |
Gyalecta flotowii |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Coenogonium luteum |
(none)
|
------------------------------ |
Coenogonium pineti |
(none)
|
TTGACCTCGGATCAGGCGGGATTACCCGCT |
Porina lectissima |
(none)
|
TTCACTTCGGATCAGGCAAGGATACCCGCT |
Rhexophiale rhexoblephara |
(none)
|
------------------------------ |
Sagiolechia protuberans |
(none)
|
TTGACCTCGGATCAGGTAGGGATACCCGCT |
Orceolina kerguelensis |
(none)
|
------------------------------ |
Placopsis perrugosa |
(none)
|
------------------------------ |
Columns
None of the columns has a description.