@ARTICLE{TreeBASE2Ref19408,
author = {Gillian Kim Brown and Daniel John Murphy and Pauline Y Ladiges},
title = {Relationships of the Australo-Malesian genus Paraserianthes (Mimosoideae: Leguminosae) identifies the sister group of Acacia sensu stricto and two biogeographic tracks},
year = {2011},
keywords = {Paraserianthes; Ingeae; Acacia; Malesia},
doi = {},
url = {http://},
pmid = {},
journal = {Cladistics},
volume = {},
number = {},
pages = {},
abstract = {Paraserianthes (tribe Ingeae) as circumscribed by Nielsen et al. (1983a,b) includes four species and five subspecies in two sections endemic to Australia, Indonesia, New Guinea and the Solomon islands. An alternative classification, proposed by Barneby and Grimes (1996), raised Nielsen?s two sections to generic level, thereby reducing Paraserianthes to include one species, P. lophantha, and recognising genus Falcataria. Neither treatment has been adopted by all. Thus a phylogenetic and systematic analysis of Paraserianthes is required to clarify the taxonomic circumscription of the genus and relationships among the species and subspecies. Furthermore, elucidation of the phylogenetic relationships of Paraserianthes is significant to an understanding of the evolutionary history and biogeography of Acacia sensu stricto.
The external transcribed spacer regions (ETS) of nuclear ribosomal DNA and the rpl32-trnL intergenic spacer of chloroplast DNA were sequenced for all species of Paraserianthes, a representative sample of Acacia sensu stricto (phyllodinous group) and 18 other members of tribe Ingeae, including an outgroup Samanea tubulosa. These data were analysed with parsimony and Bayesian methods. The topologies of the resultant phylogenetic trees were congruent but with greater resolution in the Bayesian tree. The results show that Paraserianthes sensu Nielsen is paraphyletic and that P. lophantha is the sister group to Acacia, a finding supported by morphological characters. Paraserianthes shows a dual link between Australia and lands to the north of the continent. A western biogeographic track relates south-west Western Australia to Sumatra, Java, Bali and Flores (two subspecies of P. lophantha), and an eastern track relates North East Queensland to the Moluccas, New Guinea, the Bismarck Archipelago and the Solomon Islands (P. toona and its relatives).
}
}
Matrix 7449 of Study 11115
Citation title:
"Relationships of the Australo-Malesian genus Paraserianthes (Mimosoideae: Leguminosae) identifies the sister group of Acacia sensu stricto and two biogeographic tracks".
Study name:
"Relationships of the Australo-Malesian genus Paraserianthes (Mimosoideae: Leguminosae) identifies the sister group of Acacia sensu stricto and two biogeographic tracks".
This study is part of submission 11105
(Status: Published).
Matrices
Title: Paraserianthes ETS (1-501bp) and rpl32-trnL (502-1224)
Description: Combined nrDNA and cpDNA matrix
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Abarema jupunba |
(none)
|
?TGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Albizia lebbeck |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Archidendropsis basaltica |
(none)
|
?????????????????????????????? |
Archidendropsis thozetiana |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Archidendron ellipticum |
(none)
|
?TGGTGTTTGGACTGTCTCTGCCGGCTGGC |
Archidendron hendersonii |
(none)
|
?TGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Archidendron kanisii |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Archidendron lucyi |
(none)
|
??GGTGTTTGGATTGTCTCTGCCGGCTGGC |
Acacia alata |
(none)
|
??GGTGTTTGGATCGTCTCTGCCGGCTGGC |
Acacia elata |
(none)
|
????????????TCGTCCCTGCCGGCTGGC |
Acacia genistifolia |
(none)
|
??????????????????????????TGGC |
Acacia koa |
(none)
|
?TGGTGTTTGGATCGTCCCTGCCGGCTGGC |
Acacia lycopodiifolia |
(none)
|
????????????????????GCCGGCTGGC |
Chloroleucon mangense |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Paraserianthes lophantha MEL2037057 VIC Wye River |
(none)
|
?????????GGATTGTCTCTGCCGGCTGGC |
Enterolobium contortisiliquum |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Faidherbia albida |
(none)
|
GTGGTGTTTGGATTGTCTC{CT}GCCGGCT |
Havardia pallens |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Hesperalbizia occidentalis |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCCGGC |
Paraserianthes lophantha WA |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Paraserianthes falcataria solomonensis PNG |
(none)
|
GTGGTGTTTGGACTGTCCCTGCCGGCTGGC |
Paraserianthes falcataria Indonesia |
(none)
|
????????????????????GCCGGCTGGC |
Paraserianthes toona MEL Bob Jago s.n. QLD |
(none)
|
?????????????????????????????? |
Pararchidendron pruinosum |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Pithecellobium dulce |
(none)
|
?????????????????????????????? |
Pseudosamanea guachapele |
(none)
|
??????????????GTGACTGCCGGCAGGC |
Samanea tubulosa |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Acacia longifolia |
(none)
|
?????????????????????????????? |
Wallaceodendron celebicum |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Acacia pulchella |
(none)
|
?????????????????????CCGGCTGGC |
Paraserianthes lophantha MEL2183015 VIC Midlands |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Paraserianthes toona CANB367091 |
(none)
|
GTGGTGTTTGGACTGTCTCTGCCGGCTGGC |
Paraserianthes lophantha CBG068732 South Africa |
(none)
|
GTGGTGTTTGGATTGTCTCTGCCGGCTGGC |
Paraserianthes pullenii |
(none)
|
?????????GGACTGTCTCTGCCGGCTGGC |
Paraserianthes falcataria ssp. solomonensis Solomon Islands |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.