@ARTICLE{TreeBASE2Ref29191,
author = {Dilani De Silva and Johannes (Ewald) Zacharias Groenewald and Pedro W. Crous and Peter Ades and Andi Nasruddin and Orarat Mongkolporn and Paul W.J. Taylor},
title = {Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia},
year = {2019},
keywords = {Colletotrichum, Capsicum, chili, anthracnose},
doi = {},
url = {http://},
pmid = {},
journal = {IMA Fungus},
volume = {},
number = {},
pages = {},
abstract = {Abstract: Anthracnose of chili (Capsicum spp.) causes major production losses throughout Asia where chili plants are grown. A total of 260 Colletotrichum isolates, associated with necrotic lesions of chili leaves and fruit were collected from chili producing areas of Indonesia, Malaysia, Sri Lanka, Thailand and Taiwan. Colletotrichum truncatum was the most commonly isolated species from infected chili fruit and was readily identified by its falcate spores and abundant setae in the necrotic lesions. The other isolates consisted of straight conidia (cylindrical and fusiform) which were difficult to differentiate to species based on morphological characters. Taxonomic analysis of these straight conidia isolates based on multi-gene phylogenetic analyses (ITS, gapdh, chs-1, act, tub2, his3, ApMat, gs) revealed a further seven known Colletotrichum species, C. endophyticum, C. fructicola, C. karsti, C. plurivorum, C. scovillei, C. siamense and C. tropicale. In addition, three novel species were also described as C. javanense sp. nov., C. makassarense sp. nov. and C. tainanense sp. nov. being associated with anthracnose of chili fruit in West Java (Indonesia); Makassar, South Sulawesi (Indonesia); and Tainan (Taiwan), respectively. Colletotrichum siamense was reported for the first time causing anthracnose of Capsicum annuum in Indonesia and Sri Lanka. This was also the first report of C. fructicola causing anthracnose of chili in Taiwan and Thailand and C. plurivorum in Malaysia and Thailand. Of the species with straight conidia, C. scovillei (acutatum complex), was the most prevalent throughout the surveyed countries, except for Sri Lanka from where this species was not isolated. Colletotrichum siamense (gloeosporioides complex) was also common in Indonesia, Sri Lanka and Thailand. Pathogenicity tests on chili fruit showed that C. javanense and C. scovillei were highly aggressive, especially when inoculated on non-wounded fruit, compared to all other species. The existence of new, highly aggressive exotic species, such as C. javanense, poses a biosecurity risk to production in countries which do not have adequate quarantine regulations to restrict the entry of exotic pathogens. }
}
Matrix 49047 of Study 23829

Citation title:
"Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia".

Study name:
"Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia".

This study is part of submission 23829
(Status: Published).
Matrices
Title: Boninense complex
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Colletotrichum karstii CPC_28553 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CPC_28554 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CPC_28601 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CPC_28602 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii GM44-L01 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_132134 |
(none)
|
?????????????????????????????? |
Colletotrichum karstii CBS_127595 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_129815 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_125468 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CAUOS1 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_129834 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CAUOS7 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_128545 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_128548 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum karstii CBS_129927 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum phyllanthi CBS_175.67 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum annellatum CBS_129826 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum petchii CBS_378.94 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum beeveri CBS_128527 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum brassicicola CBS_101059 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTACAA |
Colletotrichum boninense CBS_123755 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTACAA |
Colletotrichum brasiliense CBS_128501 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTATAA |
Colletotrichum constrictum CBS_128504 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCTACAA |
Colletotrichum truncatum CBS_151.35 |
(none)
|
AGGGATCATTACTGAGTTACCGCTCATCAA |
Columns
None of the columns has a description.