CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 11256 of Study 17149

About Citation title: "Phylogenetic analyses of eurotiomycetous endophytes reveal their close affinities to Chaetothyriales, Eurotiales, and a new order - Phaeomoniellales".
About Study name: "Phylogenetic analyses of eurotiomycetous endophytes reveal their close affinities to Chaetothyriales, Eurotiales, and a new order - Phaeomoniellales".
About This study is part of submission 17149 (Status: Published).


Title: 5-Gene nt123 part Complete


Taxon Label Row Segments Characters 1–30
Astraptes enotrus AENO  (none) ??????????????????????????????
Janiodes laverna nigripuncta JCER  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Lacosoma chiridota LCH2  (none) ??????????????????????????????
Malacosoma americanum MAME2  (none) ??????????????????????????????
Mimoides branchus MIBR  (none) ??????????????????????????????
Pseudothyatira cymatophoroides PCYM  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Phaedropsis alitemeralis PPY122  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Mesocondyla dardusalis PPY224  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Sosineura mimica SMIM  (none) ??????????????????????????????
Carthaea saturnioides TB032177  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Trichoplusia ni TNI  (none) ??????????????????????????????
Alucita sp ALSP  (none) ??????????????????????????????
Atteva punctella ATPU2  (none) ??????????????????????????????
Fulgoraecia exigua ESP2  (none) ??????????????????????????????
Pollanisus sp POSP  (none) ??????????????????????????????
Accinctapubes albifasciata ACAL  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Cyclidia substigmaria modesta CYSU  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Eupithecia acutipennis EUAC  (none) ??????????????????????????????
Rhodoneura terminalis LTE  (none) ??????????????????????????????
Lyssa zampa LZA  (none) ??????????????????????????????
Macrosoma satellitiata satellitiata MSSA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pentina flammans PFLA  (none) ??????????????????????????????


None of the columns has a description.