@ARTICLE{TreeBASE2Ref17692,
author = {Torsten H. Struck and Nancy Schult and Tiffany Kusen and Emily Hickman and Christoph Bleidorn and Damhnait McHugh and Kenneth M. Halanych},
title = {Annelid Phylogeny and the Status of Sipuncula and Echiura},
year = {2007},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {},
number = {},
pages = {},
abstract = {Background: Annelida comprises an ancient and ecologically important animal phylum with over 16,500 described species and members are the dominant macrofauna of the deep sea. Traditionally, two major groups are distinguished: Clitellata (including earthworms, leeches) and Polychaeta (mostly marine worms). Recent analyses of molecular data suggest that Annelida may include other taxa once considered separate phyla (i.e., Echiura, and Sipuncula) and that Clitellata are derived annelids, thus rendering Polychaeta paraphyletic; however, this contradicts classification schemes of annelids developed from recent analyses of morphological characters. Given that deep-level evolutionary relationships of Annelida are poorly understood, we have analyzed comprehensive datasets based on nuclear and mitochondrial genes, and have applied rigorous testing of alternative hypotheses so that we can move towards the robust reconstruction of annelid history needed to interpret animal body plan evolution. Results: Sipuncula, Echiura, Siboglinidae, and Clitellata are all nested within polychaete annelids according to phylogenetic analyses of three nuclear genes (18S rRNA, 28S rRNA, EF1a; 4552 nucleotide positions analyzed) for 81 taxa, and 11 nuclear and mitochondrial genes for 10 taxa (additional: 12S rRNA, 16S rRNA, ATP8, COX1-3, CYTB, NAD6; 11,454 nucleotide positions analyzed). This study substantially furthers previous findings by using approximately unbiased tests and non-scaled bootstrap probability tests to compare significance of differences between alternative hypotheses. For echiurans, the polychaete group Capitellidae is corroborated as the sister taxon; while the exact placement of Sipuncula within Annelida is still uncertain, our analyses hint at an affiliation with terebellimorphs. Siboglinids are in a clade with other sabellimorphs, and clitellates fall within a polychaete clade with aeolosomatids as their possible sister group. None of our analyses support the major polychaete clades reflected in the current classification scheme of annelids, and hypothesis testing significantly rejects monophyly of Scolecida, Palpata, Canalipalpata, and Aciculata. Conclusions: Using multiple genes and explicit hypothesis testing, we show that Echiura, Siboglinidae, and Clitellata are derived annelids with polychaete sister taxa, and that Sipuncula should be included within annelids. The traditional composition of Annelida greatly underestimates the morphological diversity of this group, and inclusion of Sipuncula and Echiura implies that patterns of segmentation within annelids have been evolutionarily labile. Relationships within Annelida based on our analyses of multiple genes challenge the current classification scheme, and some alternative hypotheses are provided.}
}
Matrix 1866 of Study 1794

Citation title:
"Annelid Phylogeny and the Status of Sipuncula and Echiura".

This study was previously identified under the legacy study ID S1766
(Status: Published).
Matrices
Title: mtDNA
Description: Legacy TreeBASE Matrix ID = M3219
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Terebratalia transversa |
(none)
|
TCAGTTTGGTTTTGGCTGGAG-ATT-GGTG |
Chaetopleura Katharina |
(none)
|
TAAATTTGGTTCTAGTTTATA-ATTAATTA |
Aplysia Ilyanassa |
(none)
|
--ACTTTG-TTCT-GAT-ACA-CTCTCAGT |
Urechis caupo |
(none)
|
ATGATTTGATTCTGGTCAATAAATTAATTC |
Riftia pachyptila |
(none)
|
TTAGTTTGATTCTAGCTTAAA-ATTAGCTT |
Platynereis Nereis |
(none)
|
TTAGTTTGATCTTGGCTATCATATTGACTA |
Phascolopsis gouldi |
(none)
|
TTAGTTTGATTCTAGCTCCAACATTGACTC |
Orbinia |
(none)
|
ATTGTTTGATTCTAGCAATTCTGCTTCCTA |
Lumbricus |
(none)
|
TCAGTTTGATTCTGGCTGACAATTTAGCTC |
Clymenella Clymenura |
(none)
|
CTTGTTTGAATCTAGCTAACAATTTGGTTA |
Columns
None of the columns has a description.