@ARTICLE{TreeBASE2Ref19263,
author = {Li Yu and Pengtao Luan and Wei Jin and Oliver A. Ryder and Leona G. Chemnick and Heidi A. Davis and Yaping Zhang},
title = {Phylogenetic Utility of Nuclear Introns in Interfamilial Relationships of Caniformia (Order Carnivora).},
year = {2010},
keywords = {phylogeny; intron; Caniformia; intra-individual allele heterozygotes; transposable elements},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Biology},
volume = {},
number = {},
pages = {},
abstract = {The monophyletic group Caniformia (dog-like carnivores) in the order Carnivora comprises nine families. Except for the general consensus for the earliest divergence of Canidae and the grouping of Procyonidae and Mustelidae, conflicting phylogenetic hypotheses exist for the other caniformian families. In the present study, a data set comprising > 22kb of 22 nuclear intron loci from 16 caniformian species is used to investigate the phylogenetic utility of nuclear introns in resolving the interfamilial relationships of Caniformia. Our phylogenetic analyses support Ailuridae as the sister taxon to a clade containing Procyonidae and Mustelidae, with Mephitinae being the sister taxon to all of them. The unresolved placements of Ursidae and Pinnipeds here emphasize a need to add more data and include more taxa to resolve this problem. The present study not only resolves some of the ambiguous relationships in Caniformia phylogeny, but also shows that the non-coding nuclear markers can offer powerful complementary data for estimating the species tree. None of the newly developed introns here have previously been used for phylogeny reconstruction, thus increasing the spectrum of molecular markers available to mammalian systematics. Interestingly, all the newly developed intron data partitions exhibit intra-individual allele heterozygotes (IIAHs). There are 115 cases of IIAHs in total. The incorporation of IIAHs into phylogenetic analysis not only provides insights into the interfamilial relationships of Caniformia but also identifies two potential hybridization events occurred within Ursidae and Otariidae, respectively. Finally, the powers and pitfalls of phylogenetics using nuclear introns as markers are discussed in the context of Caniformia phylogeny.}
}
Matrix 6770 of Study 10901

Citation title:
"Phylogenetic Utility of Nuclear Introns in Interfamilial Relationships of Caniformia (Order Carnivora).".

Study name:
"Phylogenetic Utility of Nuclear Introns in Interfamilial Relationships of Caniformia (Order Carnivora).".

This study is part of submission 10891
(Status: Published).
Matrices
Title: combined-halfgap
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Canis lupus familiaris |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Canis lupus |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Ailuropoda melanoleuca |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Ursus thibetanus |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Ursus arctos |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Arctonyx collaris |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Martes flavigula |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Mustela kathiah |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Potos flavus |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Procyon lotor |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Ailurus fulgens |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Mephitis mephitis |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Phoca vitulina |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Odobenus rosmarus |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Zalophus californianus |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Callorhinus ursinus |
(none)
|
AGCCGCATGAGTGAGCGGCAGCTGGCTCTC |
Columns
None of the columns has a description.