@ARTICLE{TreeBASE2Ref15754,
author = {Richard A. Haugland and Stephen J. Vesper and Stephen M. Harmon},
title = {Phylogenetic relationships of Memnoniella and Stachybotrys species and evaluation of morphological features for Memnoniella species identification.},
year = {2001},
keywords = {morphology; phylogenetic analysis; rDNA; taxonomy},
doi = {},
url = {http://www.jstor.org/stable/3761605},
pmid = {},
journal = {Mycologia},
volume = {93},
number = {1},
pages = {54--65},
abstract = {Members of the anamorphic fungal genus Memnoniella demonstrate morphological and biological similarities to species within the genus Stachybotrys, and the taxonomic distinctions between the genera have been the subject of controversy in the past. Sixteen strains representing described species of Memnoniella were examined for morphology using light and scanning electron microscopy and for phylogenetic relationship using comparative sequence analysis of a segment of the nuclear ribosomal RNA gene operon (rDNA) including the internal transcribed spacer 1 and 2 regions (ITS1 and ITS2) and 5.8S gene. These analyses resolved the Memnoniella strains into two highly divergent phylogenetic clades with morphologies generally consistent with the current descriptions of M. echinata and M. subsimplex. One strain, showing morphological features more similar to M. subsimplex, was placed in the M. echinata clade in the phylogenetic analysis and probably represents a new species. A second strain, showing a typical M. echinata DNA sequence, showed morphological features that were similar to Stachybotrys species when grown on certain culture media. The evolutionary relationships between the genera were evaluated by phylogenetic analyses of sequence data from the 18S, 28S, 5.8S rDNA genes and ITS1 and ITS2 regions. Results of several different analyses were in agreement in indicating that Memnoniella is paraphyletic to Stachybotrys.}
}
Matrix 3954 of Study 688

Citation title:
"Phylogenetic relationships of Memnoniella and Stachybotrys species and evaluation of morphological features for Memnoniella species identification.".

This study was previously identified under the legacy study ID S527
(Status: Published).
Matrices
Title: Fig. 1
Description: Legacy TreeBASE Matrix ID = M773
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Fusarium sambucinum NRRL13708 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTC |
Memnoniella subsimplex ATCC32334 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella subsimplex ATCC18838 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella subsimplex ATCC22700 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella subsimplex ATCC32888 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella sp. ATCC22699 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella echinata ATCC22697 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella echinata ATCC20513 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella echinata NRRL1694 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella echinata ATCC34173 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella echinata NRRL1982 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Memnoniella echinata UAMH6594 |
(none)
|
CGCCCGTCGCTACTACCGATTGAATGGCTT |
Columns
None of the columns has a description.