@ARTICLE{TreeBASE2Ref15676,
author = {C. F. D. Gurgel and Suzanne Fredericq and James N Norris},
title = {Phylogeography of Gracilaria tikvahiae (Gracilariaceae, Rhodophyta): a study of genetic discontinuity in a continuously distributed species based on molecular evidence.},
year = {2003},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Journal of Phycology},
volume = {},
number = {},
pages = {},
abstract = {Gracilaria tikvahiae, a highly morphologically variable red alga, is one of the most common species of Gracilariaceae inhabiting Atlantic estuarine environments and the Intracoastal Waterway of eastern North America. Populations of G. tikvahiae at the extremes of their geographic range (Canada and southern Mexico) are subjected to very different environmental regimes. In this study we used two types of genetic markers, the chloroplast-encoded rbcL and the nuclear ITS region, to examine the genetic variability within G. tikvahiae, to infer the taxonomic and phylogenetic relationships between geographically isolated populations and discuss its distributional information in a phylogeographic framework. Based on rbcL and ITS phylogenies, specimens from populations collected at the extreme distributional ranges reported for G. tikvahiae are indeed part of the same species; however, rbcL but not ITS based-phylogenies, detected phylogenetic structure among the 14 G. tikvahiae haplotypes found in this study. The four distinct rbcL lineages were identified as: (1) a Canadian-northeast US lineage; (2) a southeast Florida lineage; (3) an eastern Gulf of Mexico lineage; and, (4) a western Gulf of Mexico lineage. We found no evidence of G. tikvahiae occurrence in the Caribbean Sea. The genetic disjunctions coincide with hypothesized geographic barriers to gene flow, such as the southern tip of the Florida Peninsula and the mouth of the Mississippi River in the northern Gulf of Mexico. Observed phylogeographic patterns match patterns of genetic structures reported for marine animal taxa with continuous and quasi-continuous geographic distribution along the same geographic ranges.}
}
Matrix 696 of Study 1068

Citation title:
"Phylogeography of Gracilaria tikvahiae (Gracilariaceae, Rhodophyta): a study of genetic discontinuity in a continuously distributed species based on molecular evidence.".

This study was previously identified under the legacy study ID S967
(Status: Published).
Matrices
Title: chloroplast rbcL gene (RUBISCO large subunit)
Description: Legacy TreeBASE Matrix ID = M1604
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Gracilaria tikvahiae isolate 03 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 02 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 01 |
(none)
|
?????????????????????????????? |
Gracilaria lacinulata |
(none)
|
?????????????????????????????A |
Gracilaria damaecornis |
(none)
|
ATGTCCAAACTCTGAGAAGACGGCCAAGAA |
Gracilaria tikvahiae isolate 20 |
(none)
|
????????????GTAGAAGACGGCCAAGAA |
Gracilaria tikvahiae isolate 19 |
(none)
|
???????????????????????CCAAGAA |
Gracilaria tikvahiae isolate 18 |
(none)
|
??????????????????????CAGGCAGA |
Gracilaria tikvahiae isolate 17 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 16 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 14 |
(none)
|
????????????????????CAGGACAGTA |
Gracilaria tikvahiae isolate 13 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 12 |
(none)
|
??????????????????????CAGGCAGA |
Gracilaria tikvahiae isolate 11 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 10 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 09 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 08 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 07 |
(none)
|
?????????????????????????AAGAA |
Gracilaria tikvahiae isolate 06 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 05 |
(none)
|
?????????????????????????????? |
Gracilaria tikvahiae isolate 04 |
(none)
|
??????????????????GCAGGACAGGCA |
Columns
None of the columns has a description.