@ARTICLE{TreeBASE2Ref20087,
author = {Jamjan Meeboon and iman - hidayat and Kartini Kramadibrata and Dian Nurcahyanto and Siska Arie Siahaan and Susumu Takamatsu},
title = {Cystotheca tjibodensis (Erysiphaceae, Ascomycota): Ninety years rediscovery in Java and first finding of anamorph},
year = {2011},
keywords = {rDNA ITS sequence, Lanomyces, powdery mildew, taxonomy, Indonesia },
doi = {},
url = {http://},
pmid = {},
journal = {Mycoscience},
volume = {},
number = {},
pages = {},
abstract = {Cystotheca tjibodensis (G?um) Katumoto, formery known as Lanomyces tjibodensis (Perisporiales), is a fungus found in 1920 in Indonesia. This fungus has been known only by the type specimen, and is now regarded as a species of the Erysiphales. However, molecular data are still required to verify the taxonomic treatment. In March 2011 we rediscovered the fungus at Cibodas Botanical Garden, Java. Detailed characterizations of this tropical powdery mildew are reported in this study with both morphological and molecular bases. Anamorph of this fungus that was not found in the type specimen is also reported in this study. }
}
Matrix 10430 of Study 11971
Citation title:
"Cystotheca tjibodensis (Erysiphaceae, Ascomycota): Ninety years rediscovery in Java and first finding of anamorph".
Study name:
"Cystotheca tjibodensis (Erysiphaceae, Ascomycota): Ninety years rediscovery in Java and first finding of anamorph".
This study is part of submission 11971
(Status: Published).
Matrices
Title: Cystotheca tjibodensis
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Sawadaea nankinensis |
(none)
|
CTGAGCGTGA-GCCACGCAGGGCGC---AA |
Cystotheca lanestris ex Myrica californica AF011288 USA |
(none)
|
---------------CGCTGGGCGCCTGGC |
Cystotheca lanestris ex Quercus agrifolia AB000933 USA |
(none)
|
CTGAGCGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca lanestris ex Quercus agrifolia AF011289 USA |
(none)
|
------------GCACGCTGGGCGCCTGGC |
Cystotheca lanestris ex Quercus sp. AF073354 KOR |
(none)
|
CTGAGCGTGAAGCCACGCTGGGCGCCTGGC |
Cystotheca wrightii ex Quercus glauca AB000932 JPN |
(none)
|
CTGAGCGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca tjibodensis ex Castanopsis argentea T |
(none)
|
---GACGTGAGGCCACGCTGGGCGCCTGGC |
Cystotheca tjibodensis ex Castanopsis argentea A |
(none)
|
------------------------------ |
Columns
None of the columns has a description.