@ARTICLE{TreeBASE2Ref19996,
author = {Germinal Rouhan and Paulo H. Labiak and Emile Randrianjohany and France Rakotondrainibe},
title = {Not so Neotropical after all: the Grammitid Fern Genus Leucotrichum (Polypodiaceae) is also Paleotropical, as Revealed by a New Species from Madagascar},
year = {2011},
keywords = {cpDNA, Grammitidaceae, Indian Ocean, long-distance dispersal, phylogeny, pteridophytes},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {Based on morphological and molecular evidence (DNA sequences from six plastid regions: atpB, rbcL, trnG-trnR, trnL-trnF, atpB-rbcL, and rps4-trnS), the new fern species Leucotrichum madagascariense is described from Madagascar, where it is found in the North (Marojejy), the Centre (Andringitra), and the South (Andohahela) regions. Leucotrichum madagascariense exhibits whitish and long laminar hairs, among the other distinguishing characters of the genus: arching fronds, laminar apices subconform to the lateral pinnae, dark sclerenchyma covered by the green laminar tissue, and laterally marginate petioles. Its most remarkable feature is the lack of the rhizome scales, a character that is shared with the Neotropical L. pseudomitchellae. However, our phylogenetic results suggest that this character has evolved twice independently within the genus. In contrast, the sister relationship between the new Madagascan species and the group composed of L. schenckii and L mortonii is morphologically supported by linear and deeply pinnatifid laminae, incised 2/3?3/4 of the way to the rachis along its length. Leucotrichum madagascariense is the only representative of the genus occurring in the Old World. Because it is nested within a clade of five Neotropical species, we hypothesize that its occurrence outside the Neotropics results from one long-distance dispersal event from America, likely Southeastern Brazil, to Madagascar.}
}
Matrix 4391 of Study 11865
Citation title:
"Not so Neotropical after all: the Grammitid Fern Genus Leucotrichum (Polypodiaceae) is also Paleotropical, as Revealed by a New Species from Madagascar".
Study name:
"Not so Neotropical after all: the Grammitid Fern Genus Leucotrichum (Polypodiaceae) is also Paleotropical, as Revealed by a New Species from Madagascar".
This study is part of submission 11865
(Status: Published).
Matrices
Title: Figure 2
Description: Legacy TreeBASE Matrix ID = M4327
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Ophiocordyceps cuboidea NBRC100941 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps alboperitheciata NBRC101740 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps prolifica NBRC101750 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps ryogamiensis NBRC101751 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps alboperitheciata NBRC103836 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Hirsutella sp. NBRC103842 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps prolifica NBRC103838 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps prolifica NBRC103839 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps ryogamiensis NBRC103837 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps cuboidea NBRC103835 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps paracuboidea NBRC101739 |
(none)
|
---TCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps paracuboidea NBRC101742 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Ophiocordyceps cuboidea NBRC103834 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Cordyceps prolifica AB027370 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Cordyceps ramosopulvinata AB02 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Cordyceps kanzasiana AB027371 |
(none)
|
TCTCCGTTGGTGAACCAGCGGAGGGATCAT |
Columns
None of the columns has a description.