@ARTICLE{TreeBASE2Ref19261,
author = {Jason A. Smith and Kerry O'Donnell},
title = {A novel Fusarium causes a canker disease of the critically endangered conifer, Torreya taxifolia },
year = {2010},
keywords = {},
doi = {},
url = {http://},
pmid = {},
journal = {Plant Disease},
volume = {},
number = {},
pages = {},
abstract = {Smith, J. A., O?Donnell, K., Mount, L. L., Shin, K., Peacock, K., Trulock, A., Spector, T., Cruse-Sanders, J. and Determann, R. A novel Fusarium causes a canker disease of the critically endangered conifer, Torreya taxifolia. Plant Dis.
A canker disease of Florida torreya (Torreya taxifolia), has been implicated in the decline of this critically endangered species in its native range of northern Florida and southeastern Georgia. In our current surveys of eight Florida torreya sites, cankers were present on all dead trees and 71-100% of living trees, suggesting that a fungal pathogen might be the causal agent. To identify the causal agent, nuclear ribosomal internal transcribed spacer region (ITS rDNA) sequences were determined for 115 fungi isolated from cankers on 46 symptomatic trees sampled at three sites in northern Florida. BLASTn searches of the GenBank nucleotide database, using the ITS rDNA sequences as the query, indicated that a novel Fusarium species designated Fsp-1 might be the etiological agent. Molecular phylogenetic analyses of partial translation elongation factor 1-alpha (EF-1) and RNA polymerase second largest subunit (RPB2) gene sequences indicate that Fsp-1 represents a novel species representing one of the earliest divergences within the Gibberella clade of Fusarium. Results of pathogenicity experiments established that the four isolates of Fsp-1 tested could induce typical canker symptoms on cultivated Florida torreya in a growth chamber. Koch?s postulates were completed by the recovery and identification of Fsp-1 from cankers of the inoculated plants.
}
}
Matrix 7015 of Study 10942

Citation title:
"A novel Fusarium causes a canker disease of the critically endangered conifer, Torreya taxifolia ".

Study name:
"A novel Fusarium causes a canker disease of the critically endangered conifer, Torreya taxifolia ".

This study is part of submission 10932
(Status: Published).
Matrices
Title: FL torreya RPB2
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Fusarium cf lateritium 13622 |
(none)
|
?????????????????????????????? |
Fusarium verticillioides 20956 |
(none)
|
??????TTTGCTTCTACCCTTTCACATTTG |
Fusarium staphyleae 22316 |
(none)
|
TACACTTTTGCCTCGACACTATCCCATTTG |
Fusarium proliferatum 22944 |
(none)
|
??????TTCGCCTCTACTCTTTCACATTTG |
Fusarium mangiferae 25226 |
(none)
|
TATACTTTCGCCTCTACTCTTTCACATTTG |
Fusarium circinatum 25331 |
(none)
|
TACACCTTTGCTTCTACTCTTTCACATTTG |
Fusarium xylarioides 25486 |
(none)
|
TATACCTTTGCTTCTACTCTTTCACATTTG |
Fusarium commune 28387 |
(none)
|
TATACCTTTGCTTCTACTCTTTCACATTTG |
Fusarium virguliforme 31041 |
(none)
|
TACACCTTTGCTTCCACCCTTTCACATTTG |
Fusarium graminearum 31084 |
(none)
|
TATACATTTGCTTCCACTCTCTCGCATTTG |
Fusarium oxysporum 34936 |
(none)
|
TATACCTTTGCTTCTACTCTTTCACATTTG |
Fusarium buxicola 36148 |
(none)
|
TACACCTTTGCCTCTACCCTGTCCCATTTG |
Fusarium cf lateritium 37021 |
(none)
|
TATACTTTTGCCTCTACTCTGTCGCATTTG |
Fusarium solani pisi 45880 |
(none)
|
TACACCTTTGCATCCACTCTTTCGCATTTG |
Fusarium sp 54149 |
(none)
|
TATACCTTCGCCTCTACTCTGTCACATCTA |
Fusarium sp 54150 |
(none)
|
????????????????????????CATCTA |
Fusarium sp 54152 |
(none)
|
TATACCTTCGCCTCTACTCTGTCACATCTA |
Fusarium sp 54154 |
(none)
|
TATACCTTCGCCTCTACTCTGTCACATCTA |
Fusarium sp 54155 |
(none)
|
TATACCTTCGCCTCTACTCTGTCACATCTA |
Fusarium sp FIESC 12 a 31011 |
(none)
|
???????????????????????ACATTTA |
Fusarium sp FIESC 20 b 36575 |
(none)
|
???????????????????????ACATTTG |
Fusarium solani robiniae 22161 |
(none)
|
TACACCTTTGCATCCACTCTTTCGCATTTG |
Fusarium solani xanthoxyli 22163 |
(none)
|
TACACCTTTGCATCCACACTTTCGCATTTG |
Fusarium solani mori 22230 |
(none)
|
TACACCTTTGCATCCACTCTTTCGCATTTG |
Columns
None of the columns has a description.