@ARTICLE{TreeBASE2Ref17428,
author = {H. J. Schroers and M. M. Geldenhuis and Michael J Wingfield and Maritha H. Schoeman and Brenda D Wingfield},
title = {Classification of the guava wilt fungus Myxosporium psidii, the palm pathogen Gliocladium vermoesenii and the persimmon wilt fungus Acremonium diospyri in Nalanthamala},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {Psidium guajava wilt is known from South Africa, Malaysia and Taiwan. The fungus causing this disease, Myxosporium psidii, forms dry chains of conidia on surfaces of pseudoparenchymatous sporodochia, which develop in blisters on bark. Similar sporodochia are characteristic of Nalanthamala madreeya, the type species of Nalanthamala. Nalanthamala, therefore, is the appropriate anamorph genus for Myxosporium psidii, while Myxosporium is a nomen nudum (based on M. croceum). For M. psidii the combination Nalanthamala psidii is proposed. Nalanthamala psidii, the palm pathogen Gliocladium (Penicillium) vermoesenii, another undescribed anamorphic species from palm, two species of Rubrinectria and the persimmon pathogen Acremonium diospyri are monophyletic and belong to the Nectriaceae (Hypocreales) based on partial nuclear large subunit ribosomal DNA (LSU rDNA) analyses. Rubrinectria, therefore, is the teleomorph of Nalanthamala, in which the anamorphs are classified as N. vermoesenii, N. diospyri or Nalanthamala sp. Nalanthamala squamicola, the only other Nalanthamala species, has affinities with the Bionectriaceae and is excluded from this group. Rubrinectria/Nalanthamala species form dimorphic conidiophores and conidia in culture. Fusiform, cylindrical, or allantoid conidia arise in colorless liquid heads on acremonium-like conidiophores; ovoidal conidia with somewhat truncated ends arise in long, persistent, dry chains on penicillate conidiophores. No penicillate but irregularly branched conidiophores were observed in N. diospyri. Conidia of N. psidii that are held in chains are shorter than those of N. madreeya, of which no living material is available. Nalanthamala psidii and N. diospyri are pathogenic specifically to their hosts. They form pale yellow to pale orange or brownish orange colonies, respectively, and more or less white conidial masses. Most strains of Rubrinectria sp., Nalanthamala sp. and N. vermoesenii originate from palm hosts, form mostly greenish or olive-brown colonies and white-to-salmon conidial masses. They form a monophyletic clade to which Nalanthamala psidii and N. diospyri are related based on analyses of the internal transcribed spacer regions and 5.8S rDNA (ITS rDNA), LSU rDNA, and partial beta-tubulin gene. Few polymorphic sites in the ITS rDNA and beta-tubulin gene indicate that Nalanthamala psidii comprises two lineages, one of which has been detected only in South Africa.}
}
Matrix 1365 of Study 1316
![About](/treebase-web/images/icons/information.png)
Citation title:
"Classification of the guava wilt fungus Myxosporium psidii, the palm pathogen Gliocladium vermoesenii and the persimmon wilt fungus Acremonium diospyri in Nalanthamala".
![About](/treebase-web/images/icons/information.png)
This study was previously identified under the legacy study ID S1236
(Status: Published).
Matrices
Title: combined data set
Description: Legacy TreeBASE Matrix ID = M2152
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Bionectria ochroleuca |
(none)
|
CCGAGTTTACAACTCCCAAACCCATGTGAA |
Clonostachys miodochialis |
(none)
|
CCGAGTTTACAACTCCCAAACCCATGTGAA |
Fusarium fujikuroi |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Gibberella zeae |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala diospyri |
(none)
|
CCGAGCTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 110184 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 110187 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 110188 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 110507 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 116952 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 590 96 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 591 96 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 687 97 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala psidii CBS 912 85 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala sp CBS 357 87 |
(none)
|
CCGAGTTTACAACTCCCAAACCCTTGTGAA |
Nalanthamala sp CBS 456 92 |
(none)
|
CCGAGTTTACAACTCCCAAACCCTTGTGAA |
Nalanthamala vermoesenii CBS 110893 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala vermoesenii CBS 137 24 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala vermoesenii CBS 222 36 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala vermoesenii CBS 230 48 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala vermoesenii CBS 356 87 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Nalanthamala vermoesenii CBS 669 74 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Rubrinectria olivacea |
(none)
|
CCGAGTTTACAACTCCCAAACCCATGTGAA |
Rubrinectria sp CBS 101648 |
(none)
|
CCGAGTTTACAACTCCCAAACCCCTGTGAA |
Columns
None of the columns has a description.