@ARTICLE{TreeBASE2Ref25507,
author = {Yaoyao Cui and Chaochao Yan and Jing LI and Tianlin Sun and Bisong Yue and Xiuyue Zhang and Jing Li},
title = {Identification of CR1 Retroposons in Arborophila rufipectus and their application to Phasianidae Phylogeny},
year = {2016},
keywords = {CR1 retroposons, repetitive elements, Arborophila rufipectus, Phasianidae, phylogeny},
doi = {10.1111/1755-0998.12514},
url = {http://},
pmid = {},
journal = {Molecular Ecology Resources},
volume = {},
number = {},
pages = {},
abstract = {Chicken repeat 1 (CR1), a member of non-LTR retroposon, is an important phylogenetic marker in avian systematics. In the present study, we reported several characteristics of CR1 elements in a draft genome of Arborophila rufipectus (Sichuan partridge). According to the analyses of RepeatMasker, approximately 254,966 CR1 elements were identified in A. rufipectus, covering 6.7% of the genome. Subsequently, we selected eighteen novel CR1 elements by comparing the chicken genome, turkey genome and assembled A. rufipectus scaffolds. Here, a combined dataset comprising of twenty two CR1 loci, mitochondrial genomes and eight unlinked introns was analyzed to infer the evolutionary relationships of twelve Phasianidae species. The applicability of CR1 sequences for inferring avian phylogeny relative to mtDNA and intron sequences was investigated as well. Our results elucidated the position of A. rufipectus in Phasianidae with robust supports that it presented a sister clade to Arborophila ardens/Arborophila brunneopectus, and implied that genus Arborophila was in a basal phylogenetic position within Phasianidae and a phylogenetic affinity between Meleagris gallopavo and Pucrasia macrolopha. Therefore, this work not only resolved some of the confounding relationships among Phasianidae, but also suggested CR1 sequences could provide powerful complementary data for phylogeny reconstruction.}
}
Matrix 35064 of Study 18808
![About](/treebase-web/images/icons/information.png)
Citation title:
"Identification of CR1 Retroposons in Arborophila rufipectus and their application to Phasianidae Phylogeny".
![About](/treebase-web/images/icons/information.png)
Study name:
"Identification of CR1 Retroposons in Arborophila rufipectus and their application to Phasianidae Phylogeny".
![About](/treebase-web/images/icons/information.png)
This study is part of submission 18808
(Status: Published).
Matrices
Title: Phasianidae seven CR1 sequences
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Anas platyrhynchos |
(none)
|
CCCCATTTGTGCTGCCGCGTGTGACTGGCT |
Arborophila ardens |
(none)
|
CCCTGTTTGTGCTGCTGCCTGTGACTAGTT |
Arborophila brunneopectus |
(none)
|
CCCTGTTTGTGCTGCTGCCTGTGACTAGTT |
Arborophila rufipectus |
(none)
|
CCCTGTTTGTGCTGCTACCTGTGACTAGTT |
Chrysolophus amherstiae |
(none)
|
CCCTGTTTGTGCTGCTACCTGTG-CTAGCT |
Gallus gallus |
(none)
|
CCCTGTTTGTGTTGCTACCTGTGACTAGCT |
Lophophorus lhuysii |
(none)
|
CCCTGTTTGTGCTGCTACCTGTGACTAGCT |
Meleagris gallopavo |
(none)
|
CCCTGTTTGTGCTGCTACCTGTGACTAGCT |
Phasianus colchicus |
(none)
|
CCCTGTTTGTGCTGCTACCTGTGACTAGCT |
Pucrasia macrolopha |
(none)
|
CCCTGTTTGTGCTGCTACCTGTGACTAGCT |
Syrmaticus reevesii |
(none)
|
CCCTGTTTGTGCTGCTCCCTGTG-CTAGCT |
Tetraophasis szechenyii |
(none)
|
CCCTGTTTGTGCTCCTACCTGTGACTAGCT |
Tragopan temminckii |
(none)
|
CCCTGTTTGTGCTGCTACCTGTGACTAGCT |
Columns
None of the columns has a description.