@ARTICLE{TreeBASE2Ref17246,
author = {Antonis Rokas and Rachel J. Atkinson and Lucy Webster and Graham N. Stone},
title = {Out of Anatolia: Longitudinal gradients in genetic diversity support a Turkish origin for a circum-mediterranean oak gallwasp Andricus quercustozae.},
year = {2003},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Ecology},
volume = {},
number = {},
pages = {},
abstract = {Many studies have addressed the latitudinal gradients in intraspecific genetic diversity of European taxa generated during post-glacial range expansion from southern refuges. Though Asia Minor is known to be a centre of diversity for many taxa, relatively few studies have considered its potential role as a Pleistocene refuge or a potential source for more ancient westward range expansion into Europe. Here we address these issues for an oak gallwasp, Andricus quercustozae (Hymenoptera: Cynipidae), whose distribution extends from Morocco along the northern coast of the Mediterranean through Anatolia to Iran. We use sequence data for a fragment of the mitochondrial gene cytochrome b and allele frequency data for 12 polymorphic allozyme loci to answer the following questions: (1) Which regions represent current centres of genetic diversity for A. quercustozae? Does Asia Minor represent a discrete glacial refuge? (2) Can we infer the timescale and sequence of the colonisation processes linking current centres of diversity? Does available evidence support the conclusion that Asia Minor is the pre-glacial centre of origin for this species? Our results suggest that A. quercustozae was present in five distinct refuges (Iberia, Italy, the Balkans, south-western Anatolia and north-eastern Anatolia) with recent genetic exchange between the Italian and Hungarian refuges. The refuge(s) in Anatolia harbour the highest levels of genetic diversity, consistent with the conclusion that European populations are either (a) derived from Asia Minor, or (b) subject to more frequent population bottlenecks. Though Iberian populations show the lowest diversity for putatively selectively neutral markers, they have colonised a new oak host and represent a genetically and biologically discrete entity within the species.}
}
Matrix 12949 of Study 1000

Citation title:
"Out of Anatolia: Longitudinal gradients in genetic diversity support a Turkish origin for a circum-mediterranean oak gallwasp Andricus quercustozae.".

This study was previously identified under the legacy study ID S887
(Status: Published).
Matrices
Title: Ruppia maritima ptDNA MP
Description: Ruppia maritima ptDNA MP
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Ruppia maritima F |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima A |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia polycarpa B |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima E |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia polycarpa A |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima B |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima C |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima D |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima G |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima H |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia cirrhosa B |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
| Ruppia maritima L |
(none)
|
GTCCCTATTGTAATGCATGACTACATAACA |
Columns
None of the columns has a description.