@ARTICLE{TreeBASE2Ref18520,
author = {Maureen A. O'Leary},
title = {Parsimony analysis of total evidence from extinct and extant taxa, and the cetacean-artiodactyl question},
year = {1999},
keywords = {},
doi = {10.1111/j.1096-0031.1999.tb00269.x},
url = {},
pmid = {},
journal = {Cladistics},
volume = {15},
number = {3},
pages = {315--330},
abstract = {Many molecule-based phylogenetic analyses find that the mammalian order Artiodactyla (even-toed ungulates) is paraphyletic unless cetaceans (whales, dolphins and porpoises) are nested within it, a hypothesis that runs contrary to traditional morphology-based ideas. Here I present a total evidence analysis of this question based on 10 extant and 27 extinct taxa, using two character data partitions: (1) skeletal data, and (2) neontological data (soft morphology, retroposons, and DNA sequences [g-fibrinogen, b-casein, and k-casein and mt cytochrome b]). A sensitivity analysis varying gap cost and transversion-transition ratio over nine parameters was implemented in the sequence alignment and in the parsimony analysis. The two data partitions are significantly incongruent, and the neontological data partition includes over six times as many characters as the osteological data partition. The osteological data partition, however, samples almost three times more taxa, taxa that cannot be sampled for neontological data because they are extinct. Osteological data resulted in artiodactyl monophyly, and neontological data in artiodactyl paraphyly over all nine parameters. In the total evidence analysis the parameter most congruent with the overall character data is unresolved as to the sister taxon of Cetacea, however the Adams consensus tree favors the neontological result. Extinction of almost 90% of the clade of interest, and particularly poor knowledge of stem taxa at the base of Artiodactyla make resolution of conflicting molecule- and morphology-based phylogenetic signals particularly difficult.}
}
Matrix 4230 of Study 10029

Citation title:
"Parsimony analysis of total evidence from extinct and extant taxa, and the cetacean-artiodactyl question".

This study was previously identified under the legacy study ID S401
(Status: Published).
Matrices
Title: param c
Description: Legacy TreeBASE Matrix ID = M4495
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Equus caballus |
(none)
|
???????ATCAGCCGCTTTGTCCAGCCACA |
| Tapirus terrestris |
(none)
|
???????ATCAATCGCTTTGTCCAGCCACA |
| Camelus dromedarius |
(none)
|
AAAAAAAATCTACACCTTTCCCCAGCCCCA |
| Hexaprotodon liberiensis |
(none)
|
?????????????????????????????? |
| Hippopotamus amphibius |
(none)
|
CCC??AA??????????????????????? |
| Tragulus javanicus |
(none)
|
CCCCCAAATCCACCTCTTTCCCCAGCCACA |
| Ovis aries |
(none)
|
CCCCCAAATCCACCCCTTTGCCCAGGCACA |
| Sus barbatus |
(none)
|
AAAAAAAATCCACCAGTTTCCCCAGCCTCA |
| Balaenoptera edeni |
(none)
|
CCCAACCATCCACCACTTTTCCCAGCCACA |
| Tursiops truncatus |
(none)
|
CCCAACCATCCACCGCTTTTCCCAGCCACA |
| Arctocyon |
(none)
|
?????????????????????????????? |
| Hyopsodus |
(none)
|
?????????????????????????????? |
| Phenacodus |
(none)
|
?????????????????????????????? |
| Meniscotherium |
(none)
|
?????????????????????????????? |
| Hyracotherium |
(none)
|
?????????????????????????????? |
| Diacodexis |
(none)
|
?????????????????????????????? |
| Archaeotherium |
(none)
|
?????????????????????????????? |
| Elomeryx |
(none)
|
?????????????????????????????? |
| Agriochoerus |
(none)
|
?????????????????????????????? |
| Poebrotherium |
(none)
|
?????????????????????????????? |
| Andrewsarchus |
(none)
|
?????????????????????????????? |
| Eoconodon |
(none)
|
?????????????????????????????? |
| Hapalodectes |
(none)
|
?????????????????????????????? |
| Dissacus |
(none)
|
?????????????????????????????? |
| Ankalagon |
(none)
|
?????????????????????????????? |
| Sinonyx |
(none)
|
?????????????????????????????? |
| Pachyaena |
(none)
|
?????????????????????????????? |
| Mesonyx |
(none)
|
?????????????????????????????? |
| Synoplotherium |
(none)
|
?????????????????????????????? |
| Harpagolestes |
(none)
|
?????????????????????????????? |
| Pakicetus |
(none)
|
?????????????????????????????? |
| Ambulocetus |
(none)
|
?????????????????????????????? |
| Remingtonocetus |
(none)
|
?????????????????????????????? |
| Protocetidae sp. Cross Whale |
(none)
|
?????????????????????????????? |
| Protocetus |
(none)
|
?????????????????????????????? |
| Basilosaurus |
(none)
|
?????????????????????????????? |
| Dorudon |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.