@ARTICLE{TreeBASE2Ref18558,
author = {Pedro W. Crous and Uwe Braun and Michael J Wingfield and Alan R Wood and H. D. Shin and Bret A. Summerell and Acelino C Alfenas and Christian Joseph R. Cumagun and Johannes (Ewald) Zacharias Groenewald},
title = {Phylogeny and taxonomy of obscure genera of microfungi},
year = {2009},
keywords = {},
doi = {10.3767/003158509X461701},
url = {},
pmid = {},
journal = {Persoonia},
volume = {22},
number = {},
pages = {139--161},
abstract = {The recently generated molecular phylogeny for the kingdom Fungi, on which a new classification scheme is based, still suffers from an under representation of numerous apparently asexual genera of microfungi. In an attempt to populate the Fungal Tree of Life, fresh samples of 10 obscure genera of hyphomycetes were collected. These fungi were subsequently established in culture, and subjected to DNA sequence analysis of the ITS and LSU nrRNA genes to resolve species and generic questions related to these obscure genera. Brycekendrickomyces (Herpotrichiellaceae) is introduced as a new genus similar to, but distinct from Haplographium and Lauriomyces. Chalastospora is shown to be a genus in the Pleosporales, with two new species, C. ellipsoidea and C. obclavata, to which Alternaria malorum is added as an additional taxon under its oldest epithet, C. gossypii. Cyphellophora eugeniae is newly described in Cyphellophora (Herpotrichiellaceae), and distinguished from other taxa in the genus. Dictyosporium is placed in the Pleosporales, with one new species, D. streliziae. The genus Edenia, which was recently introduced for a sterile endophytic fungus isolated in Mexico, is shown to be a hyphomycete (Pleosporales) forming a pyronellea-like synanamorph in culture. Thedgonia is shown not to represent an anamorph of Mycosphaerella, but to belong to the Helotiales. Trochophora, however, clustered basal to the Pseudocercospora complex in the Mycosphaerellaceae, as did Verrucisporota. Vonarxia, a rather forgotten genus of hyphomycetes, is shown to belong to the Herpotrichiellaceae and Xenostigmina is confirmed as synanamorph of Mycopappus, and is shown to be allied to Seifertia in the Pleosporales. Dichotomous keys are provided for species in the various genera treated. Furthermore, several families are shown to be polyphyletic within some orders, especially in the Capnodiales, Chaetothyriales and Pleosporales.}
}
Matrix 4437 of Study 10067

Citation title:
"Phylogeny and taxonomy of obscure genera of microfungi".

This study was previously identified under the legacy study ID S2407
(Status: Published).
Matrices
Title: ITS only
Description: Legacy TreeBASE Matrix ID = M4555
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Chalastospora gossypii AY251081 |
(none)
|
------------------------------ |
| Chalastospora gossypii AY251079 |
(none)
|
------------------------------ |
| Chalastospora gossypii var. polymorpha AY251080 |
(none)
|
------------------------------ |
| Phaeosphaeriopsis musae |
(none)
|
------------------------------ |
| Alternaria alternata FJ545250 |
(none)
|
------------------------------ |
| Alternaria alternata AF347031 |
(none)
|
------------------------------ |
| Lewia ethzedia AY278833 |
(none)
|
------------------------------ |
| Lewia ethzedia AF392987 |
(none)
|
------------------------------ |
| Alternaria conjuncta AF392988 |
(none)
|
------------------------------ |
| Alternaria conjuncta FJ266475 |
(none)
|
------------------------------ |
| Alternaria triticina AY762948 |
(none)
|
------------------------------ |
| Alternaria triticina AY714476 |
(none)
|
------------------------------ |
| Chalastospora cetera |
(none)
|
-----------------------------G |
| Chalastospora obclavata |
(none)
|
------------------------------ |
| Chalastospora ellipsoidea |
(none)
|
-----------------------------G |
| Chalastospora gossypii CBS 114809 |
(none)
|
------------------------------ |
| Chalastospora gossypii CBS 114810 |
(none)
|
------------------------------ |
| Chalastospora gossypii CPC 15567 |
(none)
|
ATGGCTCAGTGAGGCGTTTGGACTGGCTCG |
| Chalastospora gossypii AF393714 |
(none)
|
------------------------------ |
| Chalastospora gossypii AF393721 |
(none)
|
------------------------------ |
| Chalastospora gossypii AF393722 |
(none)
|
------------------------------ |
| Chalastospora gossypii CBS 900.87 |
(none)
|
------------------------------ |
| Chalastospora gossypii AF393680 |
(none)
|
------------------------------ |
| Chalastospora gossypii AF393715 |
(none)
|
------------------------------ |
| Chalastospora gossypii AF393713 |
(none)
|
------------------------------ |
| Chalastospora gossypii CBS 216.65 |
(none)
|
------------------------------ |
| Chalastospora gossypii CPC 3680 |
(none)
|
---GCTCAGTGAGGCGTTTGGACTGGCTCG |
| Chalastospora gossypii CPC 3690 |
(none)
|
---GCTCAGTGAGGCGTTTGGACTGGCTCG |
Columns
None of the columns has a description.