@ARTICLE{TreeBASE2Ref18617,
author = {Marshal C. Hedin and Shahan Derkarabetian and Maureen McCormack and Casey Richart and J. W. Shultz},
title = { The phylogenetic utility of the nuclear protein-coding gene EF-1a for resolving recent divergences in Opiliones, emphasizing intron evolution.},
year = {2010},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Journal of Arachnology},
volume = {38},
number = {},
pages = {9--20},
abstract = {Our focus was to design harvestmen-specific PCR primers to target both introns and exons of the nuclear protein-coding gene Elongation Factor -1 alpha (EF-1alpha). We tested this primer set on ten genera representing all primary lineages of Opiliones, with sets of close phylogenetic relatives (i.e., sets of several congeners) included to specifically assess utility at shallow phylogenetic levels. Our research also included the collection of parallel mitochondrial protein-coding DNA sequence datasets for the congeneric sets to compare relative rates of evolution and gene tree congruence for EF-1alpha versus mitochondrial data. The harvestmen primers resulted in successful amplification for nine of ten tested genera. Exon sequences for these nine genera appear orthologous to previously-reported EF-1alpha Opiliones sequences, which were generated using RT-PCR methods. Newly-generated exon sequences are interrupted by three separate spliceosomal introns; two introns are restricted to one or two genera, but a third intron is conserved in position across all surveyed genera. Phylogenetic analyses of EF-1alpha nucleotide data for congeneric sets result in gene trees that are generally congruent with mitochondrial gene trees, with EF-1alpha phylogenetic signal coming from both intron and exon sites, and resolving apparently recent divergences (e.g., as recent as one million years ago). Overall, the combination of gene orthology, conserved intron position, and gene tree congruence at shallow levels suggest that this gene region will prove generally useful for both phylogeographic and species-level phylogenetic analyses in Opiliones, complementing already-documented utility at higher taxonomic levels.}
}
Matrix 4423 of Study 10126

Citation title:
" The phylogenetic utility of the nuclear protein-coding gene EF-1a for resolving recent divergences in Opiliones, emphasizing intron evolution.".

This study was previously identified under the legacy study ID S2469
(Status: Published).
Matrices
Title: Sabacon Ef1a
Description: Legacy TreeBASE Matrix ID = M4704
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Sabacon simoni OP2522 |
(none)
|
ACCCGAGAGCATGCCCTCCTCGCTTACACC |
| Sabacon cavicolens OP721 |
(none)
|
?CCCGAGAGCACGCTCTTCTCGCTTACACC |
| Sabacon cavicolens OP657 |
(none)
|
ACCCGAGAGCACGCTCTTCTCGCTTACACC |
| Sabacon cf cavicolens OP1283 |
(none)
|
ACCCGAGAGCACGCTCTTCTCGCTTACACC |
| Sabacon cf cavicolens OP691 |
(none)
|
ACCCGAGAGCACGCTCTTCTCGCTTACACC |
| Sabacon cf cavicolens OP1290 |
(none)
|
ACCCGAGAGCACGCTCTTCTCGCTTACACC |
Columns
None of the columns has a description.