CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 4516 of Study 10126

About Citation title: " The phylogenetic utility of the nuclear protein-coding gene EF-1a for resolving recent divergences in Opiliones, emphasizing intron evolution.".
About This study was previously identified under the legacy study ID S2469 (Status: Published).

Matrices

Title: Sclerobunus EF1a introns

Description: Legacy TreeBASE Matrix ID = M4705

Rows

Taxon Label Row Segments Characters 1?–30
Sclerobunus robustus robustus OP885  (none) GTCCGCTGTTCAGACCGTTTATTGTAAAAA
Sclerobunus robustus robustus OP1149  (none) GTCCGCTGTTCGAACAGTTTATTGTAAAGA
Sclerobunus robustus robustus OP1122  (none) GTCCGCTGTTCAGACCGTTTATTGTATAAT
Sclerobunus robustus robustus OP1164  (none) GTCCGCTGTTCAGACCGTTTATTGTATAAT

Columns

None of the columns has a description.