@ARTICLE{TreeBASE2Ref18777,
author = {Alexandra Caroline Ley and Regine Cla?en-Bockhoff},
title = {Evolution in African Marantaceae - Evidence from Phylogenetic, Ecological and Morphological Studies.},
year = {2010},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {},
number = {},
pages = {},
abstract = {The Marantaceae (~530 spp.) are one of the most species rich families within the order Zingiberales which incites the search for evolutionary factors favoring speciation. A positive influence on their divergence is ascribed to their unique explosive pollination mechanism which has been proposed to be a key-innovation. To test this hypothesis phylogenies of the two major African clades (Sarcophrynium and Marantochloa clade) were established based on data from nuclear (ITS, 5S) and chloroplast (trnL/trnL-F) DNA for an almost complete taxon sample. The phylogeny was used to parsimoniously reconstruct morphological and ecological traits and geographic distribution patterns. The resulting molecular relationships of the genera are congruent with the existing family phylogeny. As in previous studies the species Ataenidia conferta is nested within Marantochloa so that a new circumscription of Marantochloa is proposed leading to the new name Marantochloa conferta. Hybridization events, adaptation to different pollinators and Pleistocene climatic fluctuations are hypothesized evolutionary factors leading to the differences within the family. The explosive pollination mechanism might have played an important role in optimizing the mating system but did certainly not force speciation directly through mechanisms of reproductive isolation. }
}
Matrix 4719 of Study 10287

Citation title:
"Evolution in African Marantaceae - Evidence from Phylogenetic, Ecological and Morphological Studies.".

This study was previously identified under the legacy study ID S2647
(Status: Published).
Matrices
Title: ITS DNA Marantochloa clade
Description: Legacy TreeBASE Matrix ID = M5082
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Marantochloa sp. 6 |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa sp. 5 |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa sp. 3nov. |
(none)
|
ggatcattgtggaaaacctcat--cgagga |
Ataenidia conferta |
(none)
|
cgatcattgtggaaaatctcat--cgagga |
Marantochloa mildbraedii |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa cordifolia |
(none)
|
ggatcattgttgaagacctcat--taggga |
Marantochloa purpurea |
(none)
|
ggatcattgtggaaaacctcat--caagga |
Marantochloa mannii |
(none)
|
ggatcattgtggaaaacctcat--caagga |
Marantochloa sp. 2nov. |
(none)
|
ggatcattaaggaaatcctcaa--cgagga |
Marantochloa microphylla |
(none)
|
ggatcattgtggaaaacctcat--cgagga |
Marantochloa filipes |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa leucantha |
(none)
|
ggatcattgtggaaa-cctcat--cgagta |
Marantochloa monophylla |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa congensis |
(none)
|
ggatcattgtggaaaacctcat--cgagga |
Marantochloa incertifolia3 Makokou |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa incertifolia2 Monts de Cristal |
(none)
|
ggatcattgtggaaaatctcat--cgagga |
Marantochloa cuspidata |
(none)
|
------------------------------ |
Phacelophrynium interruptum |
(none)
|
--atcattgtcgaaaacctcgg--tgagga |
Afrocalathea rhizantha |
(none)
|
ggatcattgtggaaaacctctcaccgagga |
Marantochloa sp.1nov. |
(none)
|
--atcattgtggaaaacctcat--cgaggg |
Columns
None of the columns has a description.