@ARTICLE{TreeBASE2Ref16426,
author = {Hong Liu and Jennifer Trusty and Ramona Oviedo and Arne A. Anderberg and Javier Francisco-Ortega},
title = {Molecular phylogenetics of the Caribbean genera Rhodogeron and Sachsia (Asteraceae).},
year = {2003},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {International Journal of Plant Sciences},
volume = {},
number = {},
pages = {},
abstract = {Rhodogeron Griseb. and Sachsia Griseb. (Asteraceae) are two Caribbean genera. Rhodogeron is restricted to Cuba, whereas Sachsia is found in Cuba, the Bahamas, South Florida and Hispaniola. A phylogenetic study of nucleotide sequences of the chloroplast gene ndhF and of the internal transcribed spacers (ITS) of the nuclear ribosomal DNA shows that these two genera form a monophyletic group. The ndhF phylogeny places Rhodogeron and Sachsia within the tribe Plucheeae but with only very weak bootstrap support (59%). The ITS phylogeny indicates the serpentine areas of Cuba are the ancestral habitat for these genera, with a colonization route from Cuba toward the Bahamas and Florida. In addition, this study supports previous taxonomic treatments which considered S. divaricata Griseb. and S. polycephala Griseb. to be conspecific. Finally, Rhodogeron is the sister taxon to Sachsia, and we propose that it should be maintained as a distinct monospecific genus.}
}
Matrix 646 of Study 1041

Citation title:
"Molecular phylogenetics of the Caribbean genera Rhodogeron and Sachsia (Asteraceae).".

This study was previously identified under the legacy study ID S937
(Status: Published).
Matrices
Title: ITS
Description: Legacy TreeBASE Matrix ID = M1553
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Ighermia pinifolia |
(none)
|
TCGAAGCCTATAAA-GCAGAAAGACCCGTG |
| Pluchea purpurascens |
(none)
|
TCAAAACCTGCATA-GCAGAACGACCCGAG |
| Rhodogeron coronopifolius |
(none)
|
TTGAAGCCTGCATA-GCAAAACAACCTGAG |
| Sachsia divaricata 1 |
(none)
|
TCGAAGCCTGCATA-GCAGAACGACCTGAG |
| Sachsia divaricata 2 |
(none)
|
TCGAAGCCTGCATA-GCAGAACGACCTGAG |
| Sachsia polycephala BAHAMAS |
(none)
|
TCGAAGCCTGCATA-GCAGAACGACCTGAG |
| Sachsia polycephala FLORIDA |
(none)
|
TCGAAGCCTGCATA-GCAGAACGAC?TGAG |
| Sachsia Tricephala |
(none)
|
TCGAAGCCTGCATA-GCAGAACGACCTGAG |
| Vierea laevigata |
(none)
|
TCGAAGCCTATAAAAGCAAAAAGACCCGTG |
Columns
None of the columns has a description.