Matrix 5992 of Study 10644
Matrices
Title: RPB2 matrix
Description: RPB2 sequence alignment for isolates from Neofusicoccum parvum/N. ribis species complex
Rows
Taxon Label | Row Segments | Characters 1?–30 |
---|---|---|
Neofusicoccum australe CMW6837 | (none) | ????????????????GATTTCATGACCCA |
Neofusicoccum australe CMW9072 | (none) | ????????????????GATTTCATGACCCA |
Neofusicoccum parvum CMW6235 EU339569 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum MUCC673 EU339570 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum CMW9071 EU339571 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum MUCC124 EU339567 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum MUCC211 EU339566 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum MUCC676 EU339568 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum ICMP7933 EU821961 | (none) | ?????????????????????????????? |
Neofusicoccum parvum ICMP8002 EU339572 | (none) | CGTCACTCCCATTCAGGACTTCATGACCCA |
Neofusicoccum parvum ICMP8003 EU821963 | (none) | ?????????????????????????????? |
Neofusicoccum batangarum CBS124922 FJ900614 | (none) | ???CACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum batangarum CBS124924 FJ900615 | (none) | ??GCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum batangarum CBS124923 FJ900616 | (none) | ??GCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum batangarum CMW28637 FJ900617 | (none) | ACGCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum ribis CMW7772 EU339554 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum ribis CMW7773 EU339555 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum ribis CBS121_26 EU821960 | (none) | ?????????????????????????????? |
Neofusicoccum umdonicola CBS123648 EU821956 | (none) | ?????????????????????????????? |
Neofusicoccum umdonicola CBS123647 EU821945 | (none) | ?????????????????????????????? |
Neofusicoccum umdonicola CMW14096 EU821943 | (none) | ?????????????????????????????? |
Neofusicoccum umdonicola CBS123646 EU821935 | (none) | ?????????????????????????????? |
Neofusicoccum umdonicola CBS123645 EU821934 | (none) | ?????????????????????????????? |
Neofusicoccum occulatum CMW9070 EU339556 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum occulatum MUCC232 EU339559 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum occulatum MUCC286 EU339560 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum occulatum MUCC296 EU339561 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum occulatum MUCC270 EU339557 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum occulatum MUCC227 EU339558 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum sp MUCC125 EU339563 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum sp MUCC247 EU339562 | (none) | CGTCACTCCCATCCAGGACTTCATGACCCA |
Neofusicoccum cordaticola CBS123637 EU821952 | (none) | ?????????????????????????????? |
Neofusicoccum cordaticola CBS123638 EU821955 | (none) | ?????????????????????????????? |
Neofusicoccum cordaticola CBS123636 EU821936 | (none) | ?????????????????????????????? |
Neofusicoccum cordaticola CBS123635 EU821933 | (none) | ?????????????????????????????? |
Neofusicoccum cordaticola CBS123634 EU821928 | (none) | ?????????????????????????????? |
Neofusicoccum kwambonambiense CBS123643 EU821954 | (none) | ?????????????????????????????? |
Neofusicoccum kwambonambiense CBS123645 EU821953 | (none) | ?????????????????????????????? |
Neofusicoccum kwambonambiense CBS123641 EU821949 | (none) | ?????????????????????????????? |
Neofusicoccum kwambonambiense CBS123639 EU821930 | (none) | ?????????????????????????????? |
Neofusicoccum kwambonambiense MUCC210 EU339564 | (none) | CGTCACTCCCATTCAGGACTTTATGACCCA |
Neofusicoccum kwambonambiense MUCC157 EU339565 | (none) | CGTCACTCCCATTCAGGACTTTATGACCCA |
Columns
None of the columns has a description.