@ARTICLE{TreeBASE2Ref19196,
author = {Keith Martin Bayha and Micahel N Dawson},
title = {A new family of allomorphic jellyfishes, Drymonematidae (Scyphozoa, Discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton.},
year = {2010},
keywords = {adaptation, cryptic species, cryptic ecology, niche evolution, scyphomedusae},
doi = {},
url = {http://},
pmid = {},
journal = {Biological Bulletin},
volume = {219},
number = {3},
pages = {},
abstract = {Molecular analyses have revealed many cryptic species in the oceans, oftentimes permitting small morphological differences to be recognized as diagnosing species, but less commonly leading to consideration of cryptic ecology. Here, based on analyses of three nuclear (ribosomal 18S, 28S and internal transcribed spacer 1 [ITS1]) and two mitochondrial (cytochrome c oxidase subunit I [COI] and ribosomal 16S) DNA sequence markers and fifty-five morphological features, we revise the classification of the enigmatic jellyfish genus Drymonema. We describe a new scyphozoan family, Drymonematidae, elevating the previous subfamily Drymonemidae and correcting its spelling, to accommodate three species: the type species D. dalmatinum from the Mediterranean region, for which we identify a neotype, the western South Atlantic species D. gorgo and the new species D. larsoni from the western Atlantic and Caribbean, which is also described here. This revision emphasizes the remarkable morphological disparity of Drymonematidae from all other scyphomedusae, including allometric growth of the bell margin distal of the rhopalia, an annular zone of tentacles on the subumbrella, and ontogenetic loss of gastric filaments. Anatomical innovations are likely functionally related to predatory specialization on large gelatinous zooplankton, most notably the phylogenetically younger moon jellyfish Aurelia, indicating evolution of the feeding niche in Drymonematidae. This family-level revision contributes to the growing body of evidence that scyphomedusae are far more taxonomically rich, their biogeography a more detailed mosaic, and their phenotypes more nuanced than traditionally thought. Ecological and evolutionary responses to environmental change, past or future, are likely commensurately diverse.}
}
Matrix 6586 of Study 10857

Citation title:
"A new family of allomorphic jellyfishes, Drymonematidae (Scyphozoa, Discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton.".

Study name:
"A new family of allomorphic jellyfishes, Drymonematidae (Scyphozoa, Discomedusae), emphasizes evolution in the functional morphology and trophic ecology of gelatinous zooplankton.".

This study is part of submission 10847
(Status: Published).
Matrices
Title: Drymonematidae 16S
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Drymonema larsoni M0D16432Z |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema dalmatinum M0D15769M |
(none)
|
GTTCTTCGATACCTTTGAAGAATGATGCCT |
| Drymonema larsoni M0D14609W |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema larsoni M0D15762F |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema larsoni M0D15767K |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema dalmatinum M0D13158B |
(none)
|
GTTCTTCGATACCTTTGAAGAATGATGCCT |
| Drymonema larsoni M0D15761E |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema dalmatinum M0D15770N |
(none)
|
GTTCTTCGATACCTTTGAAGAATGATGCCT |
| Drymonema dalmatinum M0D15768L |
(none)
|
GTTCTTCGATACCTTTGAAGAATGATGCCT |
| Drymonema larsoni M0D16431Y |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema larsoni M0D16430X |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema dalmatinum M0D15771O |
(none)
|
GTTCTTCGATACCTTTGAAGAATGATGCCT |
| Drymonema larsoni M0D15765I |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
| Drymonema larsoni M0D15759C |
(none)
|
GTTCTTCGATACCGTTGAAGAATGATGCCT |
Columns
None of the columns has a description.