@ARTICLE{TreeBASE2Ref16542,
author = {Paul E Marek and Jason E Bond},
title = {Phylogenetic systematics of the colorful, cyanide-producing millipedes of Appalachia (Polydesmida, Xystodesmidae, Apheloriini) using a total evidence Bayesian approach},
year = {2006},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Here we provide an exemplar-approach phylogeny of the xystodesmid millipede tribe Apheloriini with a focus on genus-group relationshipsparticularly of the genus <i>Brachoria</i>. Exemplars for the phylogenetic analysis were chosen to represent the maximum breadth of morphological diversity within all nominal genera in the tribe Apheloriini, and to broadly sample the genus <i>Brachoria</i>. In addition, three closely related tribes were used (Rhysodesmini, Nannariini, and Pachydesmini). Morphological and DNA sequence data were scored for Bayesian inference of phylogeny. Phylogenetic analysis resulted in polyphyletic genera <i>Brachoria</i> and <i>Sigmoria</i>, a monophyletic Apheloriini, and a southern clade that contains most of the tribal species diversity. We used this phylogeny to track morphological character histories and reconstruct ancestral states using stochastic character mapping. Based on the findings from character mapping, the diagnostic feature of the genus <i>Brachoria</i>, the cingulum, evolved independently in two lineages. We compared our phylogeny against prior classifications using Bayes factor hypothesis-testing and found that our phylogenetic hypothesis is inconsistent with the previous hypotheses underlying the most recent classification. With our preferred total evidence phylogeny as a framework for taxonomic modifications, we describe a new genus, <i>Appalachioria</i>; supply phylogenetic diagnoses of monophyletic taxa; and provide a phylogeny-based classification for the tribe Apheloriini.}
}
Matrix 6587 of Study 1580

Citation title:
"Phylogenetic systematics of the colorful, cyanide-producing millipedes of Appalachia (Polydesmida, Xystodesmidae, Apheloriini) using a total evidence Bayesian approach".

This study was previously identified under the legacy study ID S1525
(Status: Published).
Matrices
Title: Drymonematidae COI
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Drymonema larsoni M0D16432Z |
(none)
|
-----------------GAGCGTTCTCAGC |
Drymonema dalmatinum M0D13158B |
(none)
|
CCTCTATTTAGTATTTGGGGCGTTCTCAGC |
Drymonema dalmatinum M0D15771O |
(none)
|
CCTCTATTTAGTATTTGGGGCGTTCTCAGC |
Drymonema dalmatinum M0D15769M |
(none)
|
CCTCTATTTAGTATTTGGGGCGTTCTCAGC |
Drymonema larsoni M0D15759C |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema larsoni M0D15767K |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema larsoni M0D14609W |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema larsoni M0D15765I |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema dalmatinum M0D15770N |
(none)
|
CCTCTATTTAGTATTTGGGGCGTTCTCAGC |
Drymonema larsoni M0D15761E |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema larsoni M0D16430X |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema dalmatinum M0D15768L |
(none)
|
-----------------GGGCGTTCTCAGC |
Drymonema larsoni M0D15762F |
(none)
|
CCTTTACCTAGTATTTGGAGCGTTCTCAGC |
Drymonema larsoni M0D16431Y |
(none)
|
-----------------GAGCGTTCTCAGC |
Columns
None of the columns has a description.