@ARTICLE{TreeBASE2Ref18132,
author = {Thomas P. Wilcox and F. J. Garcia de Leon and Dean A. Hendrickson and David M Hillis},
title = {Convergence among cave catfishes: long-branch attraction and a Bayesian relative rates test.},
year = {2003},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {Convergence has long been of interest to evolutionary biologists. Cave organisms appear to be ideal candidates for studying convergence in morphological, physiological and developmental traits. Here we report apparent convergence in two cave-catfishes that were described on morphological grounds as congeners: Prietella phreatophila and P. lundbergi. We collected mitochondrial DNA sequence data from 10 species of catfishes, representing five of the seven genera in Ictaluridae, as well as seven species from a broad range of siluriform outgroups. Analysis of the sequence data under parsimony supports a monophyletic Prietella. However, both maximum-likelihood and Bayesian analyses support polyphyly of the genus, with P. lundbergi sister to Ictalurus and P. phreatophila sister to Ameiurus. The topological difference between parsimony and the other methods appears to result from long-branch attraction between the Prietella species. Similarly, the sequence data do not support several other relationships within Ictaluridae supported by morphology. We develop a new Bayesian method for examining variation in molecular rates of evolution across a phylogeny.}
}
Matrix 7679 of Study 1089

Citation title:
"Convergence among cave catfishes: long-branch attraction and a Bayesian relative rates test.".

This study was previously identified under the legacy study ID S993
(Status: Published).
Matrices
Title: Sordariomycete tubB
Description: beta-tubulin of of Periglandula gen. nov.
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Xylaria atrosphaerica GQ495953 |
(none)
|
--------TACACTGAGGGTGCTGAGCTGG |
Isaria farinosa DQ079607 |
(none)
|
------------------------------ |
Beauveria bassiana AY366065 |
(none)
|
--------TACACTGAGGGTGCCGAGCTCG |
Chaetomidium subfimeti FJ666373 |
(none)
|
--------TACACCGAGGGTGCCGAGCTCG |
Annulohypoxylon elevatidiscus AY951656 |
(none)
|
--------TACACCGAGGGTGCCGAGCTTG |
Daldinia clavata AY951693 |
(none)
|
--------TACACTGAGGGTGCTGAGTTGG |
Hypoxylon duranii AY951714 |
(none)
|
--------TACACTGAAGGTGCTGAGCTGG |
Epichloe typhina X52616 |
(none)
|
--------TACACTGAGGGTGCTGAGCTGG |
Epichloe festucae AY722412 |
(none)
|
ATACGAACTACACTGAGGGTGCTGAGCTGG |
Periglandula turbinae TcorF01 HQ702604 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Periglandula ipomoeae IasaF13 HQ702605 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Periglandula ipomoeae IasaredF01 HQ702606 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Corallocytostroma ornithocopreoides FJ711475 |
(none)
|
--------TACACCGAAGGTGCTGAGCTGG |
Claviceps viridis EF473865 |
(none)
|
--------TACACTGAAGGTGCTGAGCTGG |
Claviceps purpurea FM987276 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Columns
None of the columns has a description.