@ARTICLE{TreeBASE2Ref19249,
author = {Hisayoshi Nozaki and Annette W. Coleman},
title = {A new species of Volvox sect. Merrillosphaera (Volvocaceae, Chlorophyceae) from Texas},
year = {2010},
keywords = {molecular phylogeny; morphology; taxonomy; Volvox ovalis sp. nov.; Volvox sect. Merrillosphaera},
doi = {},
url = {http://},
pmid = {},
journal = {Journal of Phycology},
volume = {},
number = {},
pages = {},
abstract = {Smith in 1944 divided the familiar genus Volvox Linnaeus into four sections, placing seven species that lacked cytoplasmic bridges between adult cells in the section Merrillosphaera. Here we describe a new member of the section Merrillosphaera originating from Texas (USA): V. ovalis M.A. Pocock ex H. Nozaki et A.W. Coleman, sp. nov. Asexual spheroids of V. ovalis are ovoid or elliptical, with a monolayer of 1,000-2,000 somatic cells that are not linked by cytoplasmic bridges, an expanded anterior region, and 8 to 12 gonidia in the posterior region. Visibly asymmetric cleavage divisions do not occur in V. ovalis embryos as they do V. carteri Stein, V. obversus (Shaw) Printz and V. africanus West, so the gonidia of the next generation are not yet recognizable in V. ovalis embryos prior to inversion. Molecular phylogenetic analyses of the five chloroplast genes and the internal transcribed spacer regions of nuclear ribosomal DNA indicated that V. ovalis is closely related to V. spermatosphaera Powers and/or V. tertius Meyer; however, V. ovalis can be distinguished from V. spermatosphaera by its larger gonidia, and from V. tertius by visible differences in gonidial chloroplast morphology.}
}
Matrix 6939 of Study 10927
Citation title:
"A new species of Volvox sect. Merrillosphaera (Volvocaceae, Chlorophyceae) from Texas".
Study name:
"A new species of Volvox sect. Merrillosphaera (Volvocaceae, Chlorophyceae) from Texas".
This study is part of submission 10917
(Status: Published).
Matrices
Title: ITS2-248
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Volvox ovalis sp. nov. |
(none)
|
ACCCTCCCACAT-ACACATGGGTGGTGTGT |
| Volvox spermatosphaera |
(none)
|
ACCCTCCC-CACTTT-CATGTGTGATGTGT |
| Volvox tertius NIES544 |
(none)
|
ACCCCCTCACACCTTACATATGTGATGTGT |
| Volvox tertius UTEX132 |
(none)
|
ACCCCCTCACACCTTACGTATGTGATGTGT |
| Volvox dissipatrix |
(none)
|
ACCCCCTCCAATCTCTCTCA-GAGA-GAGA |
| Volvox africanus |
(none)
|
GTCCC-TCACGAAACGGTCTGCCGTCACGT |
Columns
None of the columns has a description.
Go to search
Citation
Taxa
Matrices
Trees
Analyses
