@ARTICLE{TreeBASE2Ref19311,
author = {Maximilian P. Nesnidal and Martin Helmkampf and Iris Bruchhaus and Bernhard Hausdorf},
title = {The complete mitochondrial genome of Flustra foliacea (Ectoprocta, Cheilostomata) ? compositional bias affects phylogenetic analyses of lophotrochozoan relationships},
year = {2011},
keywords = {Brachiozoa; Bryozoa; compositional bias; Entoprocta; Lophotrochozoa; mitochondrial genome; phylogenomics},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Genomics},
volume = {},
number = {},
pages = {},
abstract = {Abstract
Background: The phylogenetic relationships of the lophophorate lineages, ectoprocts, brachiopods and phoronids, within Lophotrochozoa are still controversial. We sequenced an additional mitochondrial genome of the most species-rich lophophorate lineage, the ectoprocts. Although it is known that there are large differences in the nucleotide composition of mitochondrial sequences of different lineages as well as in the amino acid composition of the encoded proteins, this bias is often not considered in phylogenetic analyses. We applied several approaches for reducing compositional bias and saturation in the phylogenetic analyses of the mitochondrial sequences.
Results: The complete mitochondrial genome (16,089 bp) of Flustra foliacea (Ectoprocta, Gymnolaemata, Cheilostomata) was sequenced. All protein-encoding, rRNA and tRNA genes are transcribed from the same strand. Flustra shares long intergenic sequences with the cheilostomate ectoproct Bugula, which might be a synapomorphy of these taxa. Further synapomorphies might be the loss of the DHU arm of the tRNA L(UUR), the loss of the DHU arm of the tRNA S(UCN) and the unique anticodon sequence GAG of the tRNA L(CUN). The gene order of the mitochondrial genome of Flustra differs strongly from that of the other known ectoprocts. Phylogenetic analyses of mitochondrial nucleotide and amino acid data sets show that the lophophorate lineages are more closely related to trochozoan phyla than to deuterostomes or ecdysozoans confirming the Lophotrochozoa hypothesis. Furthermore, they support the monophyly of Cheilostomata and Ectoprocta. However, the relationships of the lophophorate lineages within Lophotrochozoa differ strongly depending on the data set and the used method. Different approaches for reducing heterogeneity in nucleotide and amino acid data sets and saturation did not result in a more robust resolution of lophotrochozoan relationships.
3
Conclusion: The contradictory and usually weakly supported phylogenetic reconstructions of the relationships among lophotrochozoan phyla based on mitochondrial sequences indicate that these alone do not contain enough information for a robust resolution of the relations of the lophotrochozoan phyla. The mitochondrial gene order is also not useful for inferring their phylogenetic relationships, because it is highly variable in ectoprocts, brachiopods and some other lophotrochozoan phyla. However, our study revealed several rare genomic changes like the evolution of long intergenic sequences and changes in the structure of tRNAs, which may be helpful for reconstructing ectoproct phylogeny.}
}
Matrix 10875 of Study 10996

Citation title:
"The complete mitochondrial genome of Flustra foliacea (Ectoprocta, Cheilostomata) ? compositional bias affects phylogenetic analyses of lophotrochozoan relationships".

Study name:
"The complete mitochondrial genome of Flustra foliacea (Ectoprocta, Cheilostomata) ? compositional bias affects phylogenetic analyses of lophotrochozoan relationships".

This study is part of submission 10986
(Status: Published).
Matrices
Title: Lophotrochozoa: 7,537 nucleotide positions
Description: Maximum likelihood
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Microcotyle sebastis |
(none)
|
--AT-------------------------- |
Echinococcus granulosus |
(none)
|
--ATGTGT---------------------- |
Schistosoma japonicum |
(none)
|
--ATTTTCGGTTTG---------------- |
Caenorhabditis elegans |
(none)
|
--ATAACAGTTATT---------------- |
Trichinella spiralis |
(none)
|
ATACCTCTACATTTACCTACAAGCAACCTC |
Spadella cephaloptera |
(none)
|
?????????????????????????????? |
Paraspadella gotoi |
(none)
|
?????????????????????????????? |
Terebratulina retusa |
(none)
|
--ATCTAGGAATTT---------------- |
Laqueus rubellus |
(none)
|
--ATTTGGGATTTT---------------- |
Terebratalia transversa |
(none)
|
----TTGCGATTTT---------------- |
Flustrellidra hispida |
(none)
|
--ATCTTTGATTTT---------------- |
Watersipora subtorquata |
(none)
|
--ATGCCTGAATTT---------------- |
Bugula neritina |
(none)
|
--ATGCATGAATTT---------------- |
Flustra foliacea |
(none)
|
--ATGCTTGAATTT---------------- |
Nautilus macromphalus |
(none)
|
--ATCTTCGAATTT---------------- |
Octopus vulgaris |
(none)
|
--ATATGTGAATTT---------------- |
Loligo bleekeri |
(none)
|
AGATATGTGAATTT---------------- |
Biomphalaria glabrata |
(none)
|
--ATTTACGACTTT---------------- |
Aplysia californica |
(none)
|
--ATATAGGACTTT---------------- |
Pupa strigosa |
(none)
|
--ATCAGCGATTTT---------------- |
Graptacme eborea |
(none)
|
--ATCTATGAATTT---------------- |
Katharina tunicata |
(none)
|
--ATATATGAATTT---------------- |
Cephalothrix simula |
(none)
|
--ATTTATGAATTT---------------- |
Lineus viridis |
(none)
|
--ATCTATGAATTT---------------- |
Loxosomella aloxiata |
(none)
|
GTATTTGTGAATTT---------------- |
Loxocorone allax |
(none)
|
ATATTTGTGAATTT---------------- |
Phoronis psammophila |
(none)
|
--ATATGCGAATTT---------------- |
Platynereis dumerilii |
(none)
|
--ATATCTGAATTT---------------- |
Clymenella torquata |
(none)
|
--ATCTACGAATTT---------------- |
Urechis caupo |
(none)
|
--ATCTCCGAATTT---------------- |
Lumbricus terrestris |
(none)
|
--ATATCCGAATTT---------------- |
Sipunculus nudus |
(none)
|
--ATCTATGATTTT---------------- |
Homo sapiens |
(none)
|
--ATAAGAAACTTT---------------- |
Xenopus laevis |
(none)
|
--ATAACTAGTTTT---------------- |
Balanoglossus carnosus |
(none)
|
--ATAACTAGCTTT---------------- |
Florometra serratissima |
(none)
|
GTATTTAATCATTT---------------- |
Arbacia lixula |
(none)
|
ATTTAAGCAGATTT---------------- |
Acropora tenuis |
(none)
|
--ATAGGGGCTATT---------------- |
Metridium senile |
(none)
|
--ATGGGCGCTATT---------------- |
Priapulus caudatus |
(none)
|
--ATATAGGGTTTT---------------- |
Epiperipatus biolleyi |
(none)
|
--ATATATAGTTTT---------------- |
Triops cancriformis |
(none)
|
--ATATACAACTTT---------------- |
Antrokoreana gracilipes |
(none)
|
--ATATGGAACTTT---------------- |
Lithobius forficatus |
(none)
|
--ATATACAATTTT---------------- |
Heptathela hangzhouensis |
(none)
|
--ATATATAATTTT---------------- |
Limulus polyphemus |
(none)
|
--ATATACAACTTT---------------- |
Penaeus monodon |
(none)
|
--ATATACAATTTT---------------- |
Tribolium castaneum |
(none)
|
--ATATGCAACTTT---------------- |
Atelura formicaria |
(none)
|
--ATATACAACTTT---------------- |
Columns
None of the columns has a description.