CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 783 of Study 1109

About Citation title: "Phylogenetic relationships among Bursaphelenchus species (Nematoda: Parasitaphelenchidae) inferred from nuclear ribosomal and mitochondrial DNA sequence.".
About This study was previously identified under the legacy study ID S1014 (Status: Published).

Matrices

Title: Sexdentati 28S

Description: Legacy TreeBASE Matrix ID = M1713

Rows

Taxon Label Row Segments Characters 1?–30
Bursaphelenchus sexdentati 180 IT  (none) AAGAGAGTGCAAGAGAACGTGAAACCGACG
Bursaphelenchus sexdentati 179 GR  (none) AAGAGAGTGCAAGAGAACGTGAAACCGACG
Bursaphelenchus sexdentati 178 DE  (none) AAGAGAGTGCAAGAGAACGTGAAACCGACG
Bursaphelenchus sexdentati 177 GR  (none) AAGAGAGTGCAAGAGAACGTGAAACCGACG
Bursaphelenchus poligraphi  (none) AAGAGAGTGCAAGAGAACGTGAAACCGACG

Columns

None of the columns has a description.