@ARTICLE{TreeBASE2Ref18088,
author = {Y. Weimin and R. M. Giblin-Davis and H. Braasch and K. Morris and W. Kelley Thomas},
title = {Phylogenetic relationships among Bursaphelenchus species (Nematoda: Parasitaphelenchidae) inferred from nuclear ribosomal and mitochondrial DNA sequence.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {},
number = {},
pages = {},
abstract = {A phylogenetic analysis using DNA sequences of the nuclear small and large subunit ribosomal RNA genes and mitochondrial cytochrome oxidase subunit I was performed. The analysis included individuals from 37 populations of 20 Bursaphelenchus species from Europe, North America, Central America and Asia representing much of the known biological diversity in this genus. Phylogenetic analysis, using several methods of inference based on SSR, LSU and mtCOI 0-fold degenerate sequences were congruent, with the greatest resolution obtained with combined datasets. Phylogenetic analysis revealed B. abruptus as the basal taxon among all investigated Bursaphelenchus species and a large number of significantly supported monophyletic groups. These clades are largely consistent with morphological and life history variation in the genus. Phylogenetic analysis of LSU rDNA sequences revealed the existence of cryptic species of B. mucronatus, B xylophilus and B. sexdentati. One monotypic genus, Rhadinaphelenchus (Hunt, 1993) (=B. cocophilus [Cobb, 1919] Baujard, 1989) was found to be included significantly within the Bursaphelenchus radiation. The molecular phylogeny also supports the novel nature of three previously unnamed species. While SSU, LSU and mtCOI gene sequences are useful for inferring phylogenetic relationships in this analysis, the LSU dataset was most informative across this genus. The mtDNA data was severely limited by non-stationary base composition and apparent saturation above the species level, and the conservative evolution of the SSU data limited the number of phylogenetically informative sites derived from that dataset.}
}
Matrix 784 of Study 1109

Citation title:
"Phylogenetic relationships among Bursaphelenchus species (Nematoda: Parasitaphelenchidae) inferred from nuclear ribosomal and mitochondrial DNA sequence.".

This study was previously identified under the legacy study ID S1014
(Status: Published).
Matrices
Title: Xylophilus COI
Description: Legacy TreeBASE Matrix ID = M1714
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Bursaphelenchus xylophilus 188 Quebec CAN |
(none)
|
GGTGGTTTTGGTAATTGAATAGTACCTTTG |
| Bursaphelenchus xylophilus 187 New Brunswick CAN |
(none)
|
GGTGGTTTTGGTAATTGAATAGTACCTTTG |
| Bursaphelenchus xylophilus 186 JP |
(none)
|
GGTGGTTTTGGTAATTGAATAGTACCTTTG |
| Bursaphelenchus xylophilus 185 CAN |
(none)
|
GGTGGTTTTGGTAATTGAATAGTACCTTTG |
| Bursaphelenchus mucronatus 168 Zusmarshausen DE |
(none)
|
GGTGGTTTTGGTAATTGAATAGTTCCTTTA |
| Bursaphelenchus mucronatus 167 Gruenberg DE |
(none)
|
GGTGGTTTTGGTAATTGAATAGTTCCTTTA |
| Bursaphelenchus mucronatus 166 DE |
(none)
|
GGTGGTTTTGGTAATTGAATAGTTCCTTTA |
| Bursaphelenchus mucronatus 165 FIN |
(none)
|
GGTGGTTTTGGTAATTGAATAGTTCCTTTA |
| Bursaphelenchus mucronatus 164 Hanestad NOR |
(none)
|
GGTGGTTTTGGTAATTGAATAGTTCCTTTA |
| Bursaphelenchus mucronatus 163 JP |
(none)
|
GGTGGTTTTGGTAATTGAATAGTTCCTTTA |
| Bursaphelenchus fraudulentus |
(none)
|
GGTGGTTTTGGTAATTGAATATTACCTCTT |
Columns
None of the columns has a description.