@ARTICLE{TreeBASE2Ref19455,
author = {Ulrike Steiner and Sarah Leibner and Christopher Lewis Schardl and Adrian Leuchtmann and Eckhard Leistner},
title = {Periglandula, a new fungal genus within the family Clavicipitaceae and its association with Convolvulaceae},
year = {2011},
keywords = {Ergoline alkaloids, ergot alkaloids, Ipomoea asarifolia, molecular systematics, Periglandula ipomoeae, Periglandula turbinae, symbiosis, Turbina corymbosa},
doi = {},
url = {},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {We describe two newly discovered fungi living on the adaxial leaf surface of plants belonging to the family Convolvulaceae, Ipomoea asarifolia (Desr.)Roem. et Schult. and Turbina corymbosa (L.)Raf. The fungi apparently are epibionts since hyphae were never observed to penetrate epidermal cells or stomata of their respective host plants, and most remarkably are intimately associated with secretory glands on the leaf surface. Hyphae and structures resembling chlamydospores and synnemata (but lacking conidia), formed by both fungal species are phenotypically nearly indistinguishable either after in vitro growth or when examined in vivo on the leaf surface. Phylogenetic trees based on aligned DNA sequences from nuclear genes for β-tubulin (tubB) and RNA Polymerase II subunit 1 (rpbA), and the mitochondrial gene for ATP synthase F0 subunit A (atp6), grouped the fungal species in a clade within the family Clavicipitaceae. Clavicipitaceous fungi isolated from the two different plant species could be distinguished by their sequences of atp6 and rpbA, and nuclear genes for γ-actin (actG), translation elongation factor 1?α (tefA), and 4?(γ,γ-dimethylallyl)tryptophan synthase (dmaW), the determinant step in ergoline (syn. ergot) alkaloid biosynthesis. Based on these findings we propose a new fungal genus, Periglandula, and describe two new species, Periglandula ipomoeae from host plant Ipomoea asarifolia, and Periglandula turbinae from Turbina corymbosa. }
}
Matrix 7679 of Study 11183

Citation title:
"Periglandula, a new fungal genus within the family Clavicipitaceae and its association with Convolvulaceae".

Study name:
"Periglandula, a new fungal genus within the family Clavicipitaceae and its association with Convolvulaceae".

This study is part of submission 11173
(Status: Published).
Matrices
Title: Sordariomycete tubB
Description: beta-tubulin of of Periglandula gen. nov.
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Xylaria atrosphaerica GQ495953 |
(none)
|
--------TACACTGAGGGTGCTGAGCTGG |
| Isaria farinosa DQ079607 |
(none)
|
------------------------------ |
| Beauveria bassiana AY366065 |
(none)
|
--------TACACTGAGGGTGCCGAGCTCG |
| Chaetomidium subfimeti FJ666373 |
(none)
|
--------TACACCGAGGGTGCCGAGCTCG |
| Annulohypoxylon elevatidiscus AY951656 |
(none)
|
--------TACACCGAGGGTGCCGAGCTTG |
| Daldinia clavata AY951693 |
(none)
|
--------TACACTGAGGGTGCTGAGTTGG |
| Hypoxylon duranii AY951714 |
(none)
|
--------TACACTGAAGGTGCTGAGCTGG |
| Epichloe typhina X52616 |
(none)
|
--------TACACTGAGGGTGCTGAGCTGG |
| Epichloe festucae AY722412 |
(none)
|
ATACGAACTACACTGAGGGTGCTGAGCTGG |
| Periglandula turbinae TcorF01 HQ702604 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
| Periglandula ipomoeae IasaF13 HQ702605 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
| Periglandula ipomoeae IasaredF01 HQ702606 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
| Corallocytostroma ornithocopreoides FJ711475 |
(none)
|
--------TACACCGAAGGTGCTGAGCTGG |
| Claviceps viridis EF473865 |
(none)
|
--------TACACTGAAGGTGCTGAGCTGG |
| Claviceps purpurea FM987276 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Columns
None of the columns has a description.