CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 11256 of Study 11299

About Citation title: "Can Deliberately Incomplete Gene Sample Augmentation Improve a Phylogeny Estimate for the Advanced Moths and Butterflies (Hexapoda: Lepidoptera)?".
About Study name: "Can Deliberately Incomplete Gene Sample Augmentation Improve a Phylogeny Estimate for the Advanced Moths and Butterflies (Hexapoda: Lepidoptera)?".
About This study is part of submission 11289 (Status: Published).

Matrices

Title: 5-Gene nt123 part Complete

Rows

Taxon Label Row Segments Characters 1­–30
Apha aequalis AAEQ  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Asterocampa celtis ACLY  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Artace cribraria ACRI  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Astraptes enotrus AENO  (none) ??????????????????????????????
Acanthobrahmaea europaea AEURO  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Archiearis parthenias APAR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Antheraea polyphemus APOL2  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Apatelodes torrefacta ATOR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Axia margarita AXSP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Biston betularia BBET  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Bombyx mori BMOR1  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Chelepteryx collesi CCOL  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Colias eurytheme CEUR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Campaea perlata CPER  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Cydia pomonella CPO  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Druentia alsa DALS  (none) GGTAACGATCTACGACCTCTACAGCCATTG
Hopliocnema brachycera HBR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Hyles lineata HLIN  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Heteropacha rileyana HRIL  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Janiodes laverna nigripuncta JCER  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Lacosoma chiridota LCH2  (none) ??????????????????????????????
Lymantria dispar LDI  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Lasiocampa quercus LQUERCUS  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Malacosoma americanum MAME2  (none) ??????????????????????????????
Macrosoma conifera MCON  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Mimoides branchus MIBR  (none) ??????????????????????????????
Macrothylacia rubi MRUBI  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Sematura luna NOTHSP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Oreta rosea OROS  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Olceclostera seraphica OSERA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Phiditia sp PBO  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pseudothyatira cymatophoroides PCYM  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Prismosticta fenestrata PFENE  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Plagodis fervidaria PFER  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Plodia interpunctella PIN  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Poecilocampa populi PPOP  (none) GGTACCGATCTCCGACCTCTACAGCCATTG
Phaedropsis alitemeralis PPY122  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Mesocondyla dardusalis PPY224  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Rupela albina PSH29  (none) GGTACCGATCTACGACCTCTACAACCATTG
Phyciodes tharos PTHA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Syngria druidaria SDRU  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Spodoptera frugiperda SFR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Sosineura mimica SMIM  (none) ??????????????????????????????
Carthaea saturnioides TB032177  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Trichoplusia ni TNI  (none) ??????????????????????????????
Tolype notialis TNOT  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Trogoptera salvita TSAV  (none) GGTAACGATCTACGACCTCTACAGCCATTG
Apoda biguttata ABIG2  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Alucita sp ALSP  (none) ??????????????????????????????
Amauta cacica AMCA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Argyrotaenia alisellana ARGA  (none) GGTACCGATCTACGACCTCTACAACCATTG
Atteva punctella ATPU2  (none) ??????????????????????????????
Caloptilia bimaculatella CBIM  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Euclemensia bassettella COLE  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Cyclotorna sp CYSP  (none) GGTACCGATCTACGACCTCTACAAGCATTG
Dalcerides ingenita DING2  (none) GGTACCGAGCTACGACCTCTACAGCCATTG
Acraga philetera DSP  (none) GGTACCGAGCTACGACCTCTACAGCCATTG
Euclea delphinii EDEL3  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Ethmia eupostica EEU  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Emmelina monodactyla EMON  (none) GGTACCGATCTACGACCAGTACAGCCATTG
Fulgoraecia exigua ESP2  (none) ??????????????????????????????
Eterusia aedea ETSP  (none) GGTACCGATCTACGACCTCTACAAACATTG
Hemerophila felis HFEL  (none) GGTACCGATCTACGACCTCTACATCCATTG
Lacturidae Gen sp LACT  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Lagoa crispata LCR2  (none) GGTACCGATCTACGACCTCTACAACCATTG
Melittia cucurbitae MCUC2  (none) GGTAACGATCTACGACCTCTACAGCCATTG
Platynota idaeusalis PIDA2  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pollanisus sp POSP  (none) ??????????????????????????????
Prionoxystus robiniae PROB2  (none) GGTACCGATCTACGACCTCTACAACCATTG
Pryeria sinica PSIN  (none) GGTACCGATCTACGACCTCTACAAACATTG
Podosesia syringae PSY2  (none) GGTAGTGCTCTACGACCTCTACAGCCATTA
Synemon plana SPLA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Tineola bisselliella TBI3  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Tinea columbariella TCO2  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Urodus decens URSP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Eucalantica sp YSP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Zeuzera coffeae ZCOF  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Accinctapubes albifasciata ACAL  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Acropteris sparsaria ACRO  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Aethes promptana AESP  (none) GGTACCGATCTACGACCTCTACAACCATTG
Aidos osorius AIOS  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Anacrusis nephrodes ANNE  (none) GGTACCGATCTACGACCTCTACAACCATTG
Epiblema abruptana BASP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Catoptria oregonica CAOR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Cisseps fulvicollis CFU2  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Chlorosea margaretaria CMAR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pandemis limitata CNSP  (none) GGTACCGATCTACGACCTCTACAACCATTG
Clepsis melaleucana CRS  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Cyclidia substigmaria modesta CYSU  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Cyclophora sp CYTR  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Dichromodes sp DICH  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Discophlebia sp DISC  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Dinophalus lechriomita DLEC  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Doa sp DOA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Dysodia sp DYSO  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Epicopeia hainesii EHAI  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Eupithecia acutipennis EUAC  (none) ??????????????????????????????
Pelochrista zomonana EUSP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Gauna aegusalis GAEG  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Gluphisia septentrionis GSEP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Hypobapta xenomorpha HXEN  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Hyblaea firmamentum HYFM  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Lactura subfervens LSUB  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Rhodoneura terminalis LTE  (none) ??????????????????????????????
Lyssa zampa LZA  (none) ??????????????????????????????
Macrotheca sp MACRO  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Monoloxis flavicinctalis MFLA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Micronoctua karsholti MKA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Meganola phylla MMI1  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Macrosoma satellitiata satellitiata MSSA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Orthonama obstipata ONST  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Petrophila confusalis PCON  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pentina flammans PFLA  (none) ??????????????????????????????
Papilio glaucus PGLA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Psychostrophia melanargia PMEL  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pieris rapae PRAP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Hypena scabra PSC2  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Pterodecta felderi PTFE  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Scopula limboundata SCLI  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Eudonia spenceri SCSP  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Scirpophaga incertulas SIN  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Trichopteryx carpinata TRCA  (none) GGTACCGATCTACGACCTCTACAGCCATTG
Urbanus doryssus UDO  (none) GGTACCGATCTACGACCTCTACAGCCATTG

Columns

None of the columns has a description.