CiteULike CiteULike
Delicious Delicious
Connotea Connotea

Matrix 2403 of Study 1130

About Citation title: "Pucara (Amaryllidaceae) reduced to synonomy with Stenomesson on the basis of nuclear and plastid DNA spacer sequences, and a new related species of Stenomesson.".
About This study was previously identified under the legacy study ID S1037 (Status: Published).

Matrices

Title: atpB-rbcL spacer

Description: Legacy TreeBASE Matrix ID = M1765

Rows

Taxon Label Row Segments Characters 1?–30
Eucharis formosa  (none) ??????????????????????????????
Eucharis castelnaeana  (none) ??????????????????????TAGGTTTT
Eucrosia dodsonii  (none) ??????????????????????????TGTT
Stenomesson chloranthum  (none) ????AATTTGAGCGATGCGCCCTAGGTTTT
Stenomesson latifolium  (none) ???????????????????CC-TACGTTTT
Pucara leucantha  (none) ?????ATTTGAGCGATGCGCCCTAGGTTTT
Stenomesson miniatum  (none) ??????????????????GCC-CTGGTTTT
Hymenocallis tubiflora  (none) ????????????????GCGCGCTAGGTTTT
Hymenocallis latifolia  (none) ???????????????TGCGCCCTAGGTTTT
Ismene vargasii  (none) ????AATTTGAGCGATGCGCCCTAGGTTTT
Hymenocallis chiapasiana  (none) ???????????????????CCCTATGTTTT
Hymenocallis glauca  (none) ????????????????GCGCCCTAGGTTTT
Stenomesson aurantiacum  (none) CAATAATTTGAGCGATGCGCCCTAGGTTTT
Clinanthus humilis  (none) ????????????CGATGCGCCCTACGTTTT
Clinanthus incarnatus  (none) ??????????CCCCTTGCGCCCTA-GTTTT
Clinanthus mirabilis  (none) ?????????????????????????GTTTT
Chlidanthus fragrans  (none) ????AATTTGAGCGATGCGCCCTAGGTTTT
Eustephia darwinii  (none) ????AATTTGAGCGATGCGCCCTAGGTTTT

Columns

None of the columns has a description.