Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 589 of Study 1130
Citation title: "Pucara (Amaryllidaceae) reduced to synonomy with Stenomesson on the basis of nuclear and plastid DNA spacer sequences, and a new related species of Stenomesson.".
This study was previously identified under the legacy study ID S1037
(Status: Published).
Matrices
Title: 3_for_Syd_with_4moretaxa.MC
Description: Legacy TreeBASE Matrix ID = M1489
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Tricoryne sp. | (none) | ?????????????????????????????? |
| Stypandra glauca | (none) | ?????????????????????????????? |
| Pasithea coerulea | (none) | ?????????????????????????????? |
| Corynotheca micrantha | (none) | ?????????????????????????????? |
| Zephyra elegans | (none) | ???????????????????????????AAT |
| Xeronema callistemon | (none) | ?????????????????????????????? |
| Xanthorrhoea Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAACCAAT |
| Weldenia candida | (none) | ?????????????????????????????? |
| Walleria mackenzii | (none) | ?????????????????????????????? |
| Tulbaghia Composite Taxon | (none) | ?????????????????????????????T |
| Tecophilaea cyanocrocus | (none) | ???????????????????????AATCAAT |
| Stemona japonica | (none) | ????????????????????GGAGATCAAT |
| Sphaeradenia pendula | (none) | ?????????????????????????????? |
| Sowerbaea juncea | (none) | ????????????????????GAGATTCAAT |
| Simethis mattiazii | (none) | ?????????????????????????????? |
| Rhodohypoxis millioides | (none) | ??????????????????????GATTCAAT |
| Philydrella pygmaea | (none) | ???????????????????????AATCAAT |
| Pancratium canariensis | (none) | ???????????????????????GATGAAT |
| Ornithogalum Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAATCAAT |
| Nolina recurvata | (none) | ??????????????????????????CAAT |
| Allium siculum | (none) | ?????????????????????????????? |
| Musa Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAATCAAT |
| Muilla maritima | (none) | ???????????????????AGAGAATCAAT |
| Milula spicata | (none) | ?????????????????????????????? |
| Milligania stylosa | (none) | ???????????????????????AATCAAT |
| Milla magnifica | (none) | ?????????????????????????????? |
| Maranta Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAACCAA{ |
| Lomandra Thysanotus Composite Taxon | (none) | ??????????????????ATGAGAATCAAT |
| Lilium superbum | (none) | ????????????????????GAGAATCAAT |
| Leucocrinum montanum | (none) | ?????????????????????????TCAAT |
| Lanaria lanata | (none) | ??????????????????????GAATCAAT |
| Kniphofia uvaria | (none) | ????????????????????GAGAATCAAT |
| Ixiolirion tataricum | (none) | ??????????????????ATGAGAATCAAT |
| Isophysis tasmanica | (none) | ??????????????????????GAATCAAT |
| Iris Composite Taxon | (none) | ?????????????????????????????? |
| Ipheion Composite Taxon | (none) | ??????????????????????GATTCAAT |
| Hyacinthus orientalis | (none) | GAAAATTATGTGATAATTATGAGAACCAAC |
| Herreria montevidensis | (none) | ??????????????????????????CAAT |
| Hemiphylacus latifolius | (none) | ?????????????????????????????? |
| Hemerocallis Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAACCAA{ |
| Helmholtzia Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAACCAAT |
| Hanguana malayana | (none) | ?????????????????????????????? |
| Gladiolus Composite Taxon | (none) | ?????????????????????????????? |
| Geosiris aphylla | (none) | ?????????????????????????????? |
| Freycinetia scandens | (none) | ???????????????????ATGGAATCAAT |
| Eustephia darwinii | (none) | ?????????????????????????TCAAT |
| Eriospermum bayeri | (none) | ??????????????????ATGAGAATCAAT |
| Epipactis helleborine | (none) | ?????????????????????????????? |
| Empodium veratrifolium | (none) | ??????????????????ATGAGAATCAAT |
| Echeandia sp. | (none) | ?????????????????????????????? |
| Doryanthes excelsa | (none) | ?????????????????????????????? |
| Dianella Composite Taxon | (none) | ??????????????????ATGAGAATCAAT |
| Cypripedium Composite Taxon | (none) | ?????????????????????????????? |
| Cyanastrum Kabuyea Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAACCAAT |
| Convallaria Composite Taxon | (none) | GAAAATTATGTGATAATTATGAGAACCAAT |
| Clivia Composite Taxon | (none) | ??????????????????????GAATCAAT |
| Campynema linearis | (none) | ????????????????????GAGAATCAAT |
| Calochortus mimimus | (none) | ?????????????????????????????? |
| Caesia contorta | (none) | ????????????????????????ATCAAT |
| Brodiaea Composite Taxon | (none) | ?????????????????????????????? |
| Borya septentrionalis | (none) | ?????????????????????????????? |
| Blandfordia punicea | (none) | ????????????????????GAGAATCAAT |
| Bessera elegans | (none) | ??????????????????????????CAAT |
| Behnia reticulata | (none) | ???????????????????????AATCAAT |
| Barbacenia elegans | (none) | ??????????????????ATGAGAATCAAT |
| Astelia alpina | (none) | ?????????????????????????????? |
| Aspidistra elatior | (none) | ??????????????????ATGAGATTCAAT |
| Asphodelus aestivus | (none) | ?????????????????????????????? |
| Asparagus officinalis | (none) | ??????????????????????GAATCAAT |
| Apostasia stylidioides | (none) | ??????????????????ATGAGAATCAAT |
| Aphyllanthes monspeliensis | (none) | ???????????????????????AATCAAT |
| Anthericum liliago | (none) | ?????????????????????????????? |
| Anigozanthos flavidus | (none) | ?????????????????????????????? |
| Anemarrhena asphodeloides | (none) | ??????????????????????GAATCAAT |
| Amaryllis belladona | (none) | ???????????????????????AATCAAT |
| Aloe vera | (none) | GAAAATTATGTGATAATTATGAGAACCAAT |
| Allium altaicum | (none) | ?????????????????????????????? |
| Albuca shawii | (none) | ????????????????????????TTAAAA |
| Alania endlicheri | (none) | ?????????????????????????????? |
| Agave Composite taxon | (none) | ??????????????????????GAATCAAT |
| Agapanthus campanulatus | (none) | ?????????????????????????????? |
| Agapanthus africanus | (none) | ??????????????????ATGAGAATCAAT |
Columns
None of the columns has a description.
