@ARTICLE{TreeBASE2Ref19598,
author = {Mathieu Badets and Ian Whittington and Fabrice Lalubin and Jean-Fran?ois Allienne and Jean-luc Maspimby and Sophie Bentz and Louis Du Preez and Diane Barton and Hideo Hasegawa and Veena Tandon and Rangpenyubai Imkongwapang and Annemarie Ohler and Claude Combes and Olivier Verneau},
title = {Correlating Early Evolution of Parasitic Platyhelminths to Gondwana Break-up},
year = {2011},
keywords = {Amphibia, Neobatrachia, Platyhelminthes, Polystomatidae, Coevolution, Vicariant biogeography, Gondwana break-up, Cophylogeny, Codivergence},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Biology},
volume = {},
number = {},
pages = {},
abstract = {Investigating patterns and processes of parasite diversification over ancient geological
periods should involve comparisons of host and parasite phylogenies in a biogeographic context. It
has been shown previously that the geographical distribution of host-specific parasites of
sarcopterygians was guided, from Palaeozoic to Cainozoic times, mostly by evolution and
diversification of their freshwater hosts. Here we propose phylogenies of neobatrachian frogs and
their specific parasites (Platyhelminthes, Monogenea) to investigate coevolutionary processes and
historical biogeography of polystomes and further discuss all the possible assumptions that may
account for the early evolution of these parasites. Phylogenetic analyses of concatenated rRNA
nuclear genes (18S and partial 28S) supplemented by cophylogenetic and biogeographic vicariance
analyses reveal four main parasite lineages that can be ascribed to centres of diversity, namely
Australia, India, Africa and South America. In addition, the relationships among these
biogeographical monophyletic groups, substantiated by molecular dating, reflect sequential origins
during the break-up of Gondwana. The Australian polystome lineage may have been isolated during
the first stages of the break-up, whereas the Indian lineage would have arisen after the complete
separation of western and eastern Gondwanan components. Next, polystomes would have
codiverged with hyloid sensu stricto and ranoid frog lineages before the completion of South
American and African plate separation. Ultimately they would have undergone an extensive
diversification in South America when their ancestral host families diversified. Therefore, the
presence of polystome parasites in specific anuran host clades, and in discrete geographic areas,
reveals the importance of biogeographic vicariance in diversification processes and supports the
occurrence and radiation of amphibians over ancient and recent geological periods.}
}
Matrix 8384 of Study 11362

Citation title:
"Correlating Early Evolution of Parasitic Platyhelminths to Gondwana Break-up".

Study name:
"Correlating Early Evolution of Parasitic Platyhelminths to Gondwana Break-up".

This study is part of submission 11352
(Status: Published).
Matrices
Title: Nucelar 18s 28s polystome matrice
Description: DNA 2 genes
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Polystoma gallieni |
(none)
|
TCATATGCTTGTCTCAAAGATTAAGCCATG |
Polystoma integerrimum |
(none)
|
-------------------ATTAAGCCATG |
Polystoma testimagna |
(none)
|
----------------------AAGCCATG |
Polystoma dawiekokis |
(none)
|
TAATATGCTTGTCTCAAAGATTAAGCCATG |
Polystoma marmorati |
(none)
|
-------------------ATTAAGCCATG |
Polystoma spHC |
(none)
|
----------------------AAGCCATG |
Polystoma naevius |
(none)
|
----------------------AAGCCATG |
Polystoma nearcticum |
(none)
|
TCATATGCTTGTCTCAAAGATTAAGCCATG |
Polystoma lopezromani |
(none)
|
-------------------ATTAAGCCATG |
Polystoma sp2 |
(none)
|
-------------TCAAAGATTAAGCCATG |
Polystoma cuvieri |
(none)
|
-------------------ATTAAGCCATG |
Wetapolystoma almae |
(none)
|
-------------------ATTAAGCCATG |
Eupolystoma Alluaudi |
(none)
|
-------------------ATTAAGCCATG |
Eupolystoma sp1 |
(none)
|
----------GTCTCAAAGATTAAGCCATG |
Polystoma spRA |
(none)
|
----------------------AAGCCATG |
Polystoma spRV1 |
(none)
|
----------------------AAGCCATG |
Polystoma spRO |
(none)
|
----------------------AAGCCATG |
Polystoma indicum |
(none)
|
---------------------------ATG |
Parapolystoma sp |
(none)
|
------------CTCAAAGATTAAGCCATG |
Diplorchis ranae |
(none)
|
-----TGCTTGACTCAAAGATTAAGCCATG |
Neodiplorchis scaphiopodis |
(none)
|
-------------------ATTAAGCCATG |
Pseudodiplorchis americanus |
(none)
|
TCATATGCTTGTCTCAAAGATTAAGCCATG |
Protopolystoma xenopodis |
(none)
|
-------------------ATTAAGCCATG |
Columns
None of the columns has a description.