@ARTICLE{TreeBASE2Ref17812,
author = {P. t. g. The IRPCM Phytoplasma/Spiroplasma Working Team},
title = {Candidatus Phytoplasma?, a taxon for the wall-less non-helical prokaryotes colonizing plant phloem and insects.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {IJSEM Papers},
volume = {},
number = {},
pages = {},
abstract = {The trivial name 'phytoplasmas' has been adopted to collectively name the wall-less non-helical prokaryotes colonizing plant phloem and insects, formerly known as mycoplasma-like organisms. Although the phytoplasmas have not yet been cultivated in vitro, phylogenetic analyses based on various conserved genes showed that they represent a distinct monophyletic clade within the class Mollicutes. It is proposed here to accommodate phytoplasmas within the genus 'Candidatus Phytoplasma' gen. nov. Given the diversity within ?Ca. Phytoplasma?, several subtaxa are needed to accommodate organisms which share less than 97.5% similarity among their 16S ribosomal DNA sequences. This paper describes the properties of 'Candidatus Phytoplasma', a taxon which includes the species ?Candidatus Phytoplasma aurantifolia? (the prokaryote associated to witches? broom disease of small-fruited acid lime), 'Ca. P. australiense' (associated with Australian grapevine yellows), 'Ca. P. fraxini' (associated with ash yellows), ?Ca. P. japonicum? (associated with Japanese Hydrangea phyllody), ?Ca. P. brasiliense?(associated with hibiscus witches? broom in Brazil), ?Ca. P. castaneae (associated with chestnut witches' broom in Korea), ?Ca. P. asteris? (associated with aster yellows), 'Ca. P. mali' (associated with apple proliferation), 'Ca. P. phoenicium' (associated with almond lethal disease), 'Ca. P. trifolii' (associated with clover proliferation), 'Ca. P. cynodontis' (associated with Bermuda grass white leaf), 'Ca. P. ziziphi' (associated with jujube witches? broom) and 7 species level taxa for which the Candidatus species has not been formally proposed yet (for the phytoplasmas associated with X-disease of peach, rice yellow dwarf, grapevine flavescence dor?e, Central American coconut lethal yellows, Tanzanian lethal decline of coconut, Nigerian lethal decline of coconut and loofah witches' broom, respectively). Additional species are needed to accommodate organisms that, despite their 16S rRNA sequence being more than 97.5% similar to that of other ?Ca. Phytoplasma? species, are characterized by distinctive biological, phytopathological and genetic properties. These include ?Ca. P. pyri? (associated with pear decline), 'Ca. P. prunorum' (associated with European stone fruit yellows), 'Ca. Phytoplasma spartii' (associated with spartium witches? broom), ?Ca. Phytoplasma rhamni? (associated with buckthorn witches' broom), 'Ca. Phytoplasma allocasuarinii' (associated with allocasuarina yellows) and two additional taxa for the elm yellows and the stolbur phytoplasmas, respectively. Conversely some organisms, despite their 16S rRNA sequence being less then 97.5% similar to that of any other 'Ca. Phytoplasma' species, are not presently described as Candidatus species due to their poor overall characterization.}
}
Matrix 2426 of Study 1141

Citation title:
"Candidatus Phytoplasma?, a taxon for the wall-less non-helical prokaryotes colonizing plant phloem and insects.".

This study was previously identified under the legacy study ID S1048
(Status: Published).
Matrices
Title: 16S rDNA reference matrix
Description: Legacy TreeBASE Matrix ID = M1788
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Candidatus Phytoplasma ziziphi |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGCGC |
Candidatus Phytoplasma vitis |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma ulmi |
(none)
|
------------------------------ |
Candidatus Phytoplasma trifolii |
(none)
|
TTTGATCCTGGCTCAGGATGAACGCTGGCG |
Candidatus Phytoplasma spartii |
(none)
|
------------------------------ |
Candidatus Phytoplasma solani |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma rhamni |
(none)
|
------------------------------ |
Candidatus Phytoplasma pyri |
(none)
|
TTTGATCCTGGCTCAGGATGAACGCTGGCG |
Candidatus Phytoplasma prunorum |
(none)
|
TTTGATCCTGGCTCAGGATGAACGCTGGCG |
Candidatus Phytoplasma pruni |
(none)
|
TTTGATCCTGGCTCAGGATGAACGCTGGCG |
Candidatus Phytoplasma phoenicium |
(none)
|
------------------------------ |
Candidatus Phytoplasma palmae |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma oryzae |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma mali |
(none)
|
TTTGATCCTGGCTCAGGATGAACGCTGGCG |
Candidatus Phytoplasma luffae |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma japonicum |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma fraxini |
(none)
|
------------------------------ |
Candidatus Phytoplasma cynodontis |
(none)
|
------------------------------ |
Candidatus Phytoplasma cocostanzaniae |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma cocosnigeriae |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma castaneae |
(none)
|
TTTGATCCTGGCTCAGGATAAACGCTGGCG |
Candidatus Phytoplasma brasiliense |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma australiense |
(none)
|
------------------------------ |
Candidatus Phytoplasma aurantifolia |
(none)
|
-------CTGGCTCAGGATGAACGCTGGCG |
Candidatus Phytoplasma asteris |
(none)
|
TTTGATCCTGGCTCAGGATTAACGCTGGCG |
Candidatus Phytoplasma allocasuarinae |
(none)
|
------------------------------ |
Acholeplasma palmae |
(none)
|
------------------------------ |
Columns
None of the columns has a description.