@ARTICLE{TreeBASE2Ref20563,
author = {Martin Kaltenpoth and Patrice Showers Corneli and Diane M Dunn and Robert B Weiss and Erhard Strohm and Jon Seger},
title = {Accelerated Evolution of Mitochondrial but Not Nuclear Genomes of Hymenoptera: New Evidence from Crabronid Wasps},
year = {2012},
keywords = {},
doi = {10.1371/journal.pone.0032826},
url = {http://www.plosone.org},
pmid = {},
journal = {PLoS ONE},
volume = {7},
number = {3},
pages = {e32826},
abstract = {Mitochondrial genes in animals are especially useful as molecular markers for the reconstruction of phylogenies among closely related taxa, due to the generally high substitution rates. Several insect orders, notably Hymenoptera and Phthiraptera, show exceptionally high rates of mitochondrial molecular evolution, which has been attributed to the parasitic lifestyle of current or ancestral members of these taxa. Parasitism has been hypothesized to entail frequent population bottlenecks that increase rates of molecular evolution by reducing the efficiency of purifying selection. This effect should result in elevated substitution rates of both nuclear and mitochondrial genes, but to date no extensive comparative study has tested this hypothesis in insects. Here we report the mitochondrial genome of a crabronid wasp, the European beewolf (Philanthus triangulum, Hymenoptera, Crabronidae), and we use it to compare evolutionary rates among the four largest holometabolous insect orders (Coleoptera, Diptera, Hymenoptera, Lepidoptera) based on phylogenies reconstructed with whole mitochondrial genomes as well as four single-copy nuclear genes (18S rRNA, arginine kinase, wingless, phosphoenolpyruvate carboxykinase). The mt-genome of P. triangulum is 16,029 bp in size with a mean A+T content of 83.6%, and it encodes the 37 genes typically found in arthropod mt genomes (13 protein-coding, 22 tRNA, and two rRNA genes). Five translocations of tRNA genes were discovered relative to the putative ancestral genome arrangement in insects, and the unusual start codon TTG was predicted for cox2. Phylogenetic analyses revealed significantly longer branches leading to the apocritan Hymenoptera as well as the Orussoidea, to a lesser extent the Cephoidea, and, possibly, the Tenthredinoidea than any of the other holometabolous insect orders for all mitochondrial but none of the four nuclear genes tested. Thus, our results suggest that the ancestral parasitic lifestyle of Apocrita is unlikely to be the major cause for the elevated substitution rates observed in hymenopteran mitochondrial genomes.}
}
Matrix 2429 of Study 12537

Citation title:
"Accelerated Evolution of Mitochondrial but Not Nuclear Genomes of Hymenoptera: New Evidence from Crabronid Wasps".

Study name:
"Accelerated Evolution of Mitochondrial but Not Nuclear Genomes of Hymenoptera: New Evidence from Crabronid Wasps".

This study is part of submission 12537
(Status: Published).
Matrices
Title: GBSSI
Description: Legacy TreeBASE Matrix ID = M1791
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Hibiscus grandiflorus FL1 allele1 |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus grandiflorus FL1 allele2 |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus grandiflorus FL2 |
(none)
|
------------CAGCCATGGCTGTAAGTA |
Hibiscus incanus FL |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus moscheutos TN |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus lasiocarpos IL |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus palustris NY |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus laevis TN |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus laevis NE |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus dasycalyx TX1 allele1 |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus dasycalyx TX1 allele2 |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus dasycalyx TX2 |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus coccineus MOBOT |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus coccineus FL |
(none)
|
GTGGACTTCCTCCAGCCATGGCTGTAAGTA |
Hibiscus trionum |
(none)
|
--GGACTTCCTCCATCCATGGCTGTAAGTA |
Columns
None of the columns has a description.