@ARTICLE{TreeBASE2Ref16098,
author = {Martyn Kennedy and Hamish G. Spencer},
title = {Phylogenies of the Frigatebirds (Fregatidae) and Tropicbirds (Phaethonidae), two divergent groups of the traditional order Pelecaniformes, inferred from mitochondrial DNA sequences.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {31},
number = {},
pages = {31--38},
abstract = {The frigatebirds (Fregatidae) and Tropicbirds (Phaethonidae) represent the most morphologically and behaviorally distinct members of the traditional Order Pelecaniformes. Using 1756 bp of mitochondrial DNA sequence consisting of the 12S, ATPase-6, ATPase-8, and COI genes obtained from all extant species, we derive a completely resolved phylogeny for both groups. The inferred relationships among these species are robust to the method of phylogenetic estimation used, and all branches are well supported, in spite of the relatively recent radiation within the frigatebirds. The two families are not closely related either to each other, or to any other putative relatives (e.g., pelicans; Pelecanidae).}
}
Matrix 2430 of Study 1144

Citation title:
"Phylogenies of the Frigatebirds (Fregatidae) and Tropicbirds (Phaethonidae), two divergent groups of the traditional order Pelecaniformes, inferred from mitochondrial DNA sequences.".

This study was previously identified under the legacy study ID S1051
(Status: Published).
Matrices
Title: mtDNA Sequence Data
Description: Legacy TreeBASE Matrix ID = M1792
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Megadyptes antipodes |
(none)
|
CTCCCCATTATATTACTACTCTGATTAACT |
Diomedea epomophora |
(none)
|
CTCATCATACTCACATCGTGAATAATCTTT |
Phalacrocorax varius |
(none)
|
TTCATCCTACTAACCTCATGACTAACATTT |
Pelecanus occidentalis |
(none)
|
?????CATACTAA?ATCATGACTGATCTTC |
Morus serrator |
(none)
|
CTCATCTTATTAATATCATGACTAACATTC |
Anhinga novaehollandiae |
(none)
|
?????????????????????????????? |
Phaethon rubricauda |
(none)
|
?????????????????????????????? |
Phaethon lepturus |
(none)
|
?????????????????????????????? |
Phaethon aethereus |
(none)
|
CTCATCATACTAGCATCCTGAATAACCTTT |
Fregata minor |
(none)
|
TTCACCCTATTAATAACATGACTCGCTTTC |
Fregata magnificens |
(none)
|
TTCACCCTATTAATAACATGACTCGCTTTC |
Fregata ariel |
(none)
|
?????????????????????????????? |
Fregata aquila |
(none)
|
???????TATTAATAACATGACTCGCTTTC |
Fregata andrewsi |
(none)
|
TTCACCCTATTAATAACATGACTCGCTTTC |
Columns
None of the columns has a description.