Go to search
Citation
Taxa
Matrices
Trees
Analyses
Matrix 15964 of Study 11603
Citation title: "Advances toward DNA-based identification and phylogeny of North American Armillaria species using elongation factor-1 alpha gene".
Study name: "Advances toward DNA-based identification and phylogeny of North American Armillaria species using elongation factor-1 alpha gene".
This study is part of submission 11593
(Status: Published).
Matrices
Title: ACT
Rows
| Taxon Label | Row Segments | Characters 1?–30 |
|---|---|---|
| Hypocrea aeruginea | (none) | ------------------------------ |
| Trichoderma aggressivum | (none) | ------------------------------ |
| Hypocrea alcalifuscescens | (none) | ------------------------------ |
| Hypocrea alni | (none) | ------------------------------ |
| Hypocrea alutacea | (none) | ------------------------------ |
| Trichoderma amazonicum | (none) | ------------------------------ |
| Hypocrea americana | (none) | ------------------------------ |
| Hypocrea andinensis | (none) | CTACAATGAGCTGCGTGTCGCCCCCGAGGA |
| Trichoderma arundinaceum | (none) | ------------------------------ |
| Trichoderma asperelloides | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma asperellum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma atrogelatinosum | (none) | ------------------------------ |
| Trichoderma atroviride | (none) | ------------------------------ |
| Trichoderma aureoviride | (none) | ------------------------------ |
| Trichoderma austrokoningii | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea avellanea | (none) | ------------------------------ |
| Trichoderma brevicompactum | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma brunneoviride | (none) | ------------------------------ |
| Trichoderma candidum | (none) | ------------------------CGAAGA |
| Trichoderma caribbaeum | (none) | ------------------------------ |
| Trichoderma catoptron | (none) | --ACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma ceraceum | (none) | ------------------------------ |
| Trichoderma ceramicum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma cerinum | (none) | ------------------------------ |
| Hypocrea chionea | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma chlorosporum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma chromospermum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma cinereoflava | (none) | ------------------------------ |
| Trichoderma cinnamomeum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma citrinoviride | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma costaricensis | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma crassum | (none) | ------------------------------ |
| Trichoderma cremeum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea crystalligena | (none) | ------------------------------ |
| Trichoderma cuneisporum | (none) | ------------------------------ |
| Hypocrea dacrymycella | (none) | ------------------------------ |
| Hypocrea danica | (none) | ------------------------------ |
| Hypocrea decipiens | (none) | ------------------------------ |
| Hypocrea delicatula | (none) | ------------------------------ |
| Trichoderma dingleyae | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma dorotheae | (none) | -----------------------------A |
| Hypocrea epimyces | (none) | ------------------------------ |
| Trichoderma erinaceus | (none) | -----ATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma estonicum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea eucorticioides | (none) | ------------------------------ |
| Trichoderma evansii | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma fertile | (none) | ------------------------------ |
| Hypocrea flaviconidia | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea fomiticola | (none) | ------------------------------ |
| Trichoderma gamsii | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma gelatinosum | (none) | ------------------------------ |
| Trichoderma ghanense | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma hamatum01 | (none) | ------------------------------ |
| Trichoderma hamatum02 | (none) | --------------------CCCCCGAGGA |
| Trichoderma hamatum03 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum01 | (none) | ------------------------------ |
| Trichoderma harzianum02 | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum03 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum04 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum05 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum06 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum07 | (none) | ?TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum08 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum09 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma harzianum10 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma helicum | (none) | ------------------------------ |
| Hypomyces | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma intricatum | (none) | ------------------------------ |
| Trichoderma koningii | (none) | ------------------------------ |
| Trichoderma koningiopsis | (none) | ----------------------CCCGAGGA |
| Hypocrea leucopus | (none) | ------------------------------ |
| Trichoderma lieckfeldtiae | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma longibrachiatum | (none) | ------------------------------ |
| Trichoderma longipile | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea lutea | (none) | ------------------------------ |
| Trichoderma martiale | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea megalocitrina | (none) | ------------------------------ |
| Trichoderma melanomagnum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea microcitrina | (none) | ---CAATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma minutisporum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea moravica | (none) | ------------------------------ |
| Hypocrea neorufa | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea nigrovirens | (none) | -TACAATGAGCTGCGTGTGGCCCCCGAGGA |
| Trichoderma novaezelandiae | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea nybergiana | (none) | ------------------------------ |
| Trichoderma oblongisporum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma ovalisporum01 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma ovalisporum02 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma pachybasioides | (none) | ------------------------------ |
| Trichoderma parapiluliferum | (none) | ------------------------------ |
| Trichoderma parareseei | (none) | ----AATGAG-TGCGTGTTGCCCCCGAGGA |
| Hypocrea parepimyces | (none) | ------------------------------ |
| Trichoderma parestonicum | (none) | ------------------------------ |
| Hypocrea parmastoi | (none) | ------------------------------ |
| Hypocrea patella | (none) | ------------------------------ |
| Trichoderma paucisporum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma petersenii | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea phyllostachydis | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAAGA |
| Hypocrea pillulifera | (none) | ------------------------------ |
| Hypocrea placentula | (none) | ------------------------------ |
| Trichoderma pleuroticola | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma pleurotum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea protopulvinata | (none) | ------------------------------ |
| Trichoderma protrudens | (none) | TTATAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma pseudokoningii | (none) | CTACAATGAGCTGCGTGTGGCCCCCGAGGA |
| Hypocrea pseudostraminea | (none) | ------------------------------ |
| Hypocrea psychrophila | (none) | TTACAATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma pubescens | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea pulvinata | (none) | ------------------------------ |
| Trichoderma reesei | (none) | ------------------------------ |
| Hypocrea rodmanii | (none) | ------------------------------ |
| Trichoderma rogersonii | (none) | --ACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma rossicum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma saturnisporum | (none) | ------------------------------ |
| Hypocrea semiorbis | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea seppoi | (none) | ------------------------------ |
| Trichoderma sinuosum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Sphaerostilbella | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea spinulosa | (none) | ------------------------------ |
| Trichoderma spirale01 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma spirale02 | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma spirale03 | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma stilbohypoxyli | (none) | ----------------GTTGC?CCCGAGGA |
| Hypocrea straminella | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma strictipile | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma strigosum | (none) | ------------------------------ |
| Trichoderma stromaticum | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea subalpina | (none) | ------------------------------ |
| Hypocrea sulawesensis | (none) | ----------GTGCGTGTTGCCCCCGAGGA |
| Hypocrea sulfurea | (none) | TTACAATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma surrotundum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea tawa | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma thailandicum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma thelephoricola | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma theobromicola | (none) | CTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma tomentosum | (none) | TTACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma turrialbense | (none) | --ACAATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma velutinum | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Trichoderma victoriensis | (none) | CTACAATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma virens | (none) | TTACAATGAGCTGCGTGTTGCTCCCGAGGA |
| Trichoderma virescentiflava | (none) | -------------------GCCCCCGAGGA |
| Trichoderma viride | (none) | ------------------------------ |
| Trichoderma viridescens | (none) | -TACAATGAGCTGCGTGTTGCCCCCGAGGA |
| Hypocrea voglmayrii | (none) | ------------------------------ |
Columns
None of the columns has a description.
