@ARTICLE{TreeBASE2Ref16634,
author = {David J. McLaughlin and R. W. J. Hanson and Elizabeth M. Frieders and Eric C. Swann and Les J. Szabo},
title = {Mitosis in the yeast phase of the basidiomycetes Bensingtonia yuccicola and Stilbum vulgare and its phylogenetic implications.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {American Journal of Botany},
volume = {91},
number = {},
pages = {},
abstract = {Phylogenetic studies of yeasts rely on an extensive molecular and biochemical data set, but structural characters are scarce. Details of mitosis in yeasts have been studied with transmission electron microscopy and immunofluorescence. Of these two methods immunofluorescence is faster and easier and yields sufficient detail for cytological comparisons. Only three basidiomyceteous yeasts have been studied thus far with immunofluorescence. Mitosis in budding cells of ascomycetous yeasts occurs in the parent, while in basidiomyceteous yeasts, except in Agaricostilbum pulcherrimum, it occurs in the bud. Mitosis in additional yeasts in the Agaricostilbomycetidae of the Urediniomycetes was observed using immunofluorescence localization of freeze-substituted material. In Stilbum vulgare, mitosis occurred in the parent, but in Bensingtonia yuccicola it occurred in the bud as in most other basidiomycetous yeasts. Stilbum vulgare also had predominantly binucleate yeast cells. Nuclear small subunit rDNA sequence data showed that A. pulcherrimum and S. vulgare are more closely related to each other than to B. yuccicola within the Agaricostilbomycetidae. Based on the few taxa examined, mitotic and cytoskeletal characters provide phylogenetic information.}
}
Matrix 2467 of Study 1164

Citation title:
"Mitosis in the yeast phase of the basidiomycetes Bensingtonia yuccicola and Stilbum vulgare and its phylogenetic implications.".

This study was previously identified under the legacy study ID S1071
(Status: Published).
Matrices
Title: 18S rDNA
Description: Legacy TreeBASE Matrix ID = M1827
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Sterigmatomyces elviae |
(none)
|
?????????????????????????????? |
| Agraicostilbum pulcherimum |
(none)
|
?????????????????????????????? |
| Chionosphaera apobasidialis |
(none)
|
?????????????????????????????? |
| Stilbum vulgare |
(none)
|
?????????????????????????????? |
| Kondoa malvinella |
(none)
|
?????????????????????AGTCATATG |
| Bensingtonia yuccicola |
(none)
|
????????????????????????????GG |
| Mixia osmundae |
(none)
|
????????????????????????????TG |
| Kriegeria eriophori |
(none)
|
?????????????????????????????? |
| Microbotryum violaceum |
(none)
|
?????????????????????????????? |
| Septobasidium burtii |
(none)
|
?????????????????????????????? |
| Septobasidium canescens |
(none)
|
?????????????????????????????? |
| Helicobasidium mompa |
(none)
|
??????????????????????GTCATATG |
| Puccinia pelargonii |
(none)
|
?????????????????????AGTCATATG |
| Helicogloea variabilis |
(none)
|
??????????????????????GTCATATG |
| Phleogena faginea |
(none)
|
????????????????????????CATATG |
| Erythrobasidium hasegawianum |
(none)
|
????????????????????????????TG |
| Sporobolomyces salicinus |
(none)
|
?????????????????????AGTCATATG |
| Trimorphomyces papilionaceus |
(none)
|
?????????????????????AGTCATATG |
| Spongipellis unicolor |
(none)
|
?????????????????????????????? |
| Graphiola cylindrica |
(none)
|
?????????????????????AGTCATACG |
| Ustilago maydis |
(none)
|
TACCTGGTTGATTCTGCCAGTAGTCATATG |
| Neurospora crassa |
(none)
|
TACCTGGTTGATTCTGCCAGTAGTCATATG |
| Eurotium rubrum |
(none)
|
?????????????????????????????? |
| Taphrina deformans |
(none)
|
?????????????????????????????? |
| Candida albicans |
(none)
|
TATCTGGTTGATCCTGCCAGTAGTCATATG |
| Saccharomyces bayanus |
(none)
|
???CTGGTTGATCCTGCCAGTAGTCATATG |
Columns
None of the columns has a description.